Labshake search
Citations for Sino Biological :
901 - 950 of 1022 citations for Mouse Anti Hantavirus Nucleocapsid Protein Antibody 4958 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Primary antibody to SARS-CoV-2 spike subunit 1 (Sino Biological, Beijing, Cat. No. 40589-T62), was diluted 1:25 in blocking solution and grids were transferred to drops of primary antibody for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated with a rabbit (2019-nCoV) S1 antibody (1:50; Sino Biological, Duesseldorf, Germany) and then incubated for 1 hour at 37°C with secondary goat anti-rabbit antibodies conjugated with fluorescein isothiocyanate (FITC ...
-
bioRxiv - Immunology 2021Quote: ... an anti-SARS-CoV-2 RBD mAb (40150-D004, Sino Biological) and anti-SARS-CoV-2 nucleocapsid antibody (MBS2563841 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-Tf (1:2000, 11019-RP02, Sino Biological Inc, China) antibodies ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit anti-SARS-CoV-2 spike (Sino Biological Inc, Beijing, China) was diluted in iBind solution (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-SARS-CoV-2 Spike S1 (Sino Biological, # 40150-R007) and rabbit anti-TMPRSS2 (Atlas Antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... and rabbit anti-MERS S1 (1:200; 40069-T52, Sino Biological). For immunofluorescence ...
-
bioRxiv - Bioengineering 2022Quote: ... rabbit anti-SARS-CoV-2 spike pAb (Sino Biological, 40592-T62), or anti-hCoV HKU1 spike monoclonal Ab (mAb ...
-
bioRxiv - Immunology 2020Quote: ... anti-TGF-β1 (1:1□000, 50698-T48, Sino Biological, China), anti-IL-10 (1:1□000 ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-C1-INH (1 µg/mL, Sino Biologicals, 10995-R018) or rabbit anti-human C1q (1:300) ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated with anti-ACE2 (Sino Biological, 10108-RP01-100) or isotype control (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... anti-SARS-CoV-2-Spike (Sino Biological, 40592-MM117, 1:2000), anti-MERS-CoV-Spike (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... rabbit anti-MERS-CoV S2 (Sino Biological, 40070-T62, 1:1000), rabbit anti-MyD88 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2021Quote: ... 100 μg of recombinant SARS-CoV-2 (2019-nCoV) spike S1 protein (Cat: 40591-V08H and 40591-V08H10, Sino Biological, endotoxin level: <0.001U/μg) was used per dose ...
-
bioRxiv - Genetics 2020Quote: ... Loaded sensors were dipped into recombinant SARS-Cov-2 His-tagged Spike protein (D614 or D614G, Sino Biological, Cat # 40591-V08H and 40591-V08H3).
-
bioRxiv - Immunology 2020Quote: ... and ADI-56046) were subject to two rounds of selection for binding to a recombinant SARS-CoV-2 S1 protein (Sino Biological, Cat # 40591-V08H). Induced yeast libraries covering at least 10-fold of their respective diversities were incubated with 10 or 1 nM biotinylated SARS-CoV-2 S1 protein under equilibrium conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression vector for the SARS-CoV-2 Spike protein (pCMV3-2019-nCoV-Spike (S1+S2)-long) was purchased from Sino Biological (VG40589-UT, China). The expression vector for ACE2 was purchased from Miaolinbio (pEnCMV-ACE2 (human)-3×FLAG ...
-
bioRxiv - Microbiology 2021Quote: ... Immunofluorescence experiments were performed using SARS-CoV and SARS-CoV-2 Spike antibody (40150-R007, Sino Biologicals) and Alexa-488 conjugated anti-rabbit secondary antibody (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... Sections were then incubated with rabbit polyclonal antibody against SARS-CoV S (Sino Biological, #40150-T62-COV2) at dilution 1:500 and mouse monoclonal antibody against SARS-CoV NP (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... purified SARS-CoV-2 spike-specific monoclonal rabbit primary antibody R001 (Cat. n° 40592-R001, Sino Biological).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 (2019-nCov) rabbit polyclonal spike neutralizing antibody from Sino Biological (cat no. 40592-R001) was used at 3 µM working concentration ...
-
bioRxiv - Immunology 2020Quote: ... which consists of a commercially available chimeric monoclonal SARS-CoV-2 S1 antibody (Sino Biologicals, Beijing, China) spiked into plasma from non-COVID-19 donors at levels intended to give titers similar to those found in plasma of COVID-19 donors.
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2020Quote: ... China) were coated with 2 μg/mL (50μL/well) SARS-CoV-2 Spike Protein (S1 Subunit, His tag) (Sino Biological, China, cat no:40591-V08H) in carbonate bicarbonate buffer pH9.6 and the plates were incubated at 4°C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... or S2-His proteins expressed in HEK293 (S1 and RBD) or insect cells (S2) were used (Sino Biological 40591-V08H, 40592-VNAH, and 40590-V08B). Native mass spectrometry (Olinares et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-Lipocalin-2/LCN2 (1:500, 50060-RP02; Sino Biological, China), mouse anti-NF200 (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... anti-SARS-CoV-2 N (1:1000, MA14AP1502, Sino Biological, Beijing, China) anti-P62 (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... or rabbit-anti-SARS-CoV nucleoprotein (40143-T62, 1:400, Sino biological). Tight junctions were stained using mouse-anti-ZO1 (ZO1-1A12 ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were probed with anti-spike Ab (40150-T62, Sino Biological) and anti-beta-actin Ab (A4700 ...
-
bioRxiv - Immunology 2024Quote: ... Anti-RBD mAb (clone MM57) was obtained from Sino Biologicals (Cat#40592). Streptavidin-HRP was obtained from R&D Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... primary antibodies were used to stain the SARS-CoV-2 Nucleoprotein (N; Sino Biological #40143-R019, 1:8000) and Spike protein (S ...
-
bioRxiv - Microbiology 2021Quote: ... The spike expression was detected using the SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... The spike expression was detected using a SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 spike-specific monoclonal rabbit primary antibodies R001 and R007 were obtained from Sino Biological (Wayne ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of SARS-CoV-2 Spike antigen rabbit SARS-CoV Spike S1 antibody (40150-RP01, Sino Biological) and rabbit SARS-CoV Spike primary antibody (40150-T62-COV2 ...
-
bioRxiv - Biochemistry 2019Quote: ... the PVDF membrane was incubated the primary antibodies against Tf (1:2000, 11019-RP02, Sino Biological Inc., China) at 4°C overnight ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 nucleoprotein was detected by immunohistochemistry (IHC) using the rabbit monoclonal antibody (40143-R019, Sino Biological) at a 1:15000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... 96 well NUNC MaxSorb flat-bottom plates were coated with 3.99 μg/ml recombinant SARS-CoV-2 Wuhan-Hu-1 spike RBD protein (Sino Biological, Beijing, PR China, Cat. 40592-V08B), 1 μg/ml SARS-CoV-2 Wuhan-Hu-1 nucleocapsid protein (Sino ...
-
bioRxiv - Microbiology 2021Quote: ... 96-well plates were coated overnight with either 1 μg/ml recombinant SARS-CoV-2 (2019-nCoV) Spike Protein (RBD, His Tag, Sino biological, Cat. No. 40592-V08B-100) or recombinant SARS-CoV-2 Nucleocapsid His Protein ...
-
bioRxiv - Bioengineering 2023Quote: Nectagen’s nanoCLAMP phage display library NL-21 was panned as described (Suderman et al. 2017) against SARS CoV 2 Spike protein RBD (Sino Biologicals, S1RBD-Fc, cat#40592-VO2H) for rounds 1 and 2 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SARS-Cov-2 spike S2 (Sino Biological #40590-T62, 1:1000), rabbit anti-β-actin (proteintech #20536-1-AP ...
-
bioRxiv - Bioengineering 2022Quote: ... or anti-hCoV HKU1 spike monoclonal Ab (mAb) (40021-MM07-100, Sino Biological) diluted 1:1000 in TBS with 0.1% Tween 20.
-
bioRxiv - Pathology 2022Quote: ... Rabbit anti-SARS-CoV-2 Spike S (1:200, Sino Biological, 40150-R007), Goat anti-ACE2 (1:100 ...
-
bioRxiv - Bioengineering 2020Quote: ... Bound phage were detected by incubation with anti-M13-HRP conjugate (Sino Biological)(1:5000 ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-HA murine mAb (Cat. No. 100028-MM10) was purchased from Sino Biologicals US Inc ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to PVDF membranes and immunoblotted with anti-S1 (Sino Biological, 40150-T62), anti-S2 (Sino Biological ...