Labshake search
Citations for Sino Biological :
551 - 600 of 775 citations for Mouse Anti Dengue Virus NS1 Serotype 1 Antibody OB4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-1 (Sino Biological; VG40150-CF)(Genbank AAP13567.1) ...
-
bioRxiv - Immunology 2024Quote: ... EG.5.1 and JN.1 (Sino Biological). ELISA plates (Corning ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were probed with anti-spike Ab (40150-T62, Sino Biological) and anti-beta-actin Ab (A4700 ...
-
bioRxiv - Immunology 2024Quote: ... Anti-RBD mAb (clone MM57) was obtained from Sino Biologicals (Cat#40592). Streptavidin-HRP was obtained from R&D Systems ...
-
bioRxiv - Immunology 2024Quote: ... The plates were incubated with biotinylated SARS-CoV-2 (JN.1) spike RBD protein (Sino Biological, 1 μg/ml) for 2 h and Streptavidin-AP Conjugate from Invitrogen (1.5 μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Positive control for the nucleocapsid ELISA was SARS-CoV nucleoprotein rabbit monoclonal antibody (Sino Biological Inc, Beijing, China). Negative controls were reagent grade human sera (compared to Mab CR3022) ...
-
bioRxiv - Microbiology 2021Quote: ... The spike expression was detected using the SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... cells were incubated with a primary antibody targeting SARS-CoV-2 nucleocapsid protein (Sino Biological, cat. 40143-R001) at a 1:2000 dilution for 1h ...
-
bioRxiv - Microbiology 2019Quote: ... S protein was detected using the MERS-CoV S rabbit polyclonal antibody (Sino Biological, Cat No: 40069-RP01) as the primary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... The spike expression was detected using a SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 spike-specific monoclonal rabbit primary antibodies R001 and R007 were obtained from Sino Biological (Wayne ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of SARS-CoV-2 Spike antigen rabbit SARS-CoV Spike S1 antibody (40150-RP01, Sino Biological) and rabbit SARS-CoV Spike primary antibody (40150-T62-COV2 ...
-
bioRxiv - Immunology 2020Quote: ... Fixed and permeabilized cells were first stained with a primary antibody recognizing SARS-CoV nucleocapsid protein (Sino Biological), followed by secondary antibody staining with AlexaFluor 488-conjugated goat anti-rabbit antibody ...
-
bioRxiv - Immunology 2021Quote: ... 2 uG of each antibody was separately cross-linked to 2 uG of the Spike protein (Sino Biological Inc ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 nucleoprotein was detected by immunohistochemistry (IHC) using the rabbit monoclonal antibody (40143-R019, Sino Biological) at a 1:15000 dilution ...
-
bioRxiv - Biophysics 2021Quote: ... His10-tag ICAM-1 (50440-M08H, Sino Biological) (270 ng ml-1 ...
-
bioRxiv - Microbiology 2020Quote: ... pSARS-CoV-1 was purchased from Sino Biologicals. pCAGGS expressing SARS-CoV-2 RBD was obtained from BEI Resources (cat#NR-52309) ...
-
bioRxiv - Biophysics 2020Quote: ... His10-tag ICAM-1 (50440-M08H, Sino Biological) (270 ng mL−1 ...
-
bioRxiv - Biochemistry 2020Quote: ... and 100 U ml-1 Supernuclease (Sino Biological) and then lysed by sonication ...
-
bioRxiv - Immunology 2022Quote: ... 2019-nCoV WA-1 (Sino Biological 40592-V08B), Delta variant B.1.617.2 (Sino Biological 40592-V08H90) ...
-
bioRxiv - Immunology 2021Quote: ... human ICAM-1-His (Sino Biological, #10346-H08H), and streptavidin (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... RBD (K417N/ WT/ Omicron BA.1) (Sino Biologicals) or streptavidin (catalogue #434302 ...
-
bioRxiv - Immunology 2024Quote: ... Omicron BA.1 (Sino Biological, cat. 40589-V08H26), Omicron BA.2 (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were incubated with anti-S protein Rab (Sino Biological, PA, USA) at 1:1000 in the blocking solution overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... or anti-hCoV HKU1 spike monoclonal Ab (mAb) (40021-MM07-100, Sino Biological) diluted 1:1000 in TBS with 0.1% Tween 20.
-
bioRxiv - Microbiology 2021Quote: ... Foci were stained with 50μl/well rabbit anti-nucleocapsid (Sino Biological, 40588-T62) diluted 1:1000 in 0.2% (w/v ...
-
bioRxiv - Bioengineering 2020Quote: ... Bound phage were detected by incubation with anti-M13-HRP conjugate (Sino Biological)(1:5000 ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-HA murine mAb (Cat. No. 100028-MM10) was purchased from Sino Biologicals US Inc ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to PVDF membranes and immunoblotted with anti-S1 (Sino Biological, 40150-T62), anti-S2 (Sino Biological ...
-
bioRxiv - Molecular Biology 2024Quote: ... Rabbit polyclonal anti-SARS-CoV-2 nucleoprotein N protein (40068-RP01; Sino Biological) and anti-actin (L00003 ...
-
bioRxiv - Systems Biology 2023Quote: ... blocked with 5 % BSA stained with primary anti-NP (Sino Biological 40143-R001), and secondary goat anti-rabbit IgG conjugated to Alexa Fluor 488 (Thermo Fisher Scientific A-11034) ...
-
bioRxiv - Immunology 2023Quote: ... Keytruda-biosimilar (anti-PD1(MK)-IgG4) was purchased from Sino Biological (Beijing, China). B7-H1-Fc (PD-L1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were washed and incubated in primary conjugated antibodies (EZH2, BD Bioscience; CD133, Miltenyi; CD15, Biolegend; Sox2, Sino Biological Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... polyclonal antibodies against SARS-CoV RP01 (Cat: 40150-RP01) and T52 (Cat: 40150-T52) were purchased from Sino Biological. Fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... S2 and p24 proteins were quantified using rabbit polyclonal antibody against the RBD domain (Sino Biological; Cat: 40592-T62), 1A9 anti S2 mouse monoclonal antibody (GeneTex ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were treated with methanol 0.6% H2O2 and stained for 1 h with a 1:3000 dilution of 40143-R019 rabbit mAb to SARS-CoV-2 nucleocapsid protein (Sino Biological). A 1:3000 dilution of sheep anti-rabbit HRP conjugate (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatants of Expi293™ cells transfected with pAd/SARS-CoV-2-S1SA was diluted 1:40 in PBS-T with 1% BSA and along with standard control protein 40591-V08H (rS1H, Sino Biological) or purified rSARS-CoV-2S1Beta were incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... Viral foci were detected using primary monoclonal rabbit antibodies directed against SARS-CoV-2 nucleocapsid (Sino Biological Inc., 40143-R001), and secondary anti-rabbit HRP conjugated antibodies (1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... Monoclonal antibody (Ab) against SARS-CoV-2 spike protein (IgG1 clone#43, Cat # 40591-MM43) was purchased from Sino Biological, Inc (Wanye ...
-
bioRxiv - Immunology 2021Quote: ... using a rabbit polyclonal antibody specific to SARS-CoV-2 RBD protein (cat. n° 40592-T62, Sino Biological, Beijing, China) (2/5000 ...
-
bioRxiv - Microbiology 2022Quote: ... tissue sections were deparaffinized and stained with a SARS-CoV-2 N-specific rabbit monoclonal antibody (Sino Biological #40143-R001) at a dilution of 1:30,000 followed by an anti-rabbit HRP-linked secondary (Cell Signaling #7074) ...
-
bioRxiv - Immunology 2021Quote: ... a standard curve was generated using Anti-RBD PAb (Cat: 40592-MP01 Sino Biological) or Anti-S1 (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... Staining was performed with anti-SARS-CoV-2 N (Cat # 40143-MM08, Sino Biological) as described previously (28 ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-CD45 IgG (clone #145 monoclonal recombinant, Sino Biological 100342-R145, Beijing, China). All antibodies were diluted using the antibody diluent (BiositeHisto ...
-
bioRxiv - Immunology 2021Quote: ... detected with HRP conjugated secondaries in blocking buffer (Goat anti-Rabbit HRP, Sino Biological SSA003 ...
-
bioRxiv - Biophysics 2021Quote: ... and His10-tag B7-1 (50446-M08H, Sino Biological) (130 ng ml-1 ...
-
bioRxiv - Biophysics 2020Quote: ... and His10-tag B7-1 (50446-M08H, Sino Biological) (130 ng mL−1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Nucleoprotein (N; Sino Biological #40143-R019, 1:5000) overnight ...