Labshake search
Citations for New England Biolabs :
1 - 50 of 2056 citations for pTH Related Protein Splice Isoform 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: CDKN1A intron 1 APA 3’ splice site was deleted using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) as per the manufacturer’s instructions using forward primer (5’-TCCCCACCCCAAAATGACGCGCAGCC-3’ ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μg purified DARPP-32 isoforms as well as 5 μl ATP (New England Biolabs) in kinase dilution buffer III (SignalChem ...
-
bioRxiv - Developmental Biology 2021Quote: ... Adjustment of open reading frame following the splice acceptor was accomplished via Q5 (NEB) mutagenesis by inserting a single or two nucleotides (+1 or +2 ...
-
bioRxiv - Plant Biology 2023Quote: ... and AT1G66100 which encode a PR (pathogenesis-related) protein were amplified using the Phusion High-Fidelity DNA Polymerase (New England Biolabs) from Col-0 genomic DNA with two primer pairs RBCS2B-BglII-PF (5′-CCAGATCTGGAATATTCAATGTTGACTATC-3′ ...
-
bioRxiv - Biochemistry 2021Quote: ... Cloning related enzymes were purchased from New England Biolabs (NEB). Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was amplified with primers flanking each splice site by Taq polymerase (NEB, Hitchin, UK) (thermocycling parameters outlined in Table 3) ...
-
bioRxiv - Plant Biology 2024Quote: ... when OD600 reached 0.5 for 4 h at 37 °C and then they were purified using amylose resin column (New England Biolabs, for MBP related proteins purification) or Ni-NTA agarose column (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric constructs of both syntaxin isoforms were obtained using Gibson Assembly (NEB). For the viral infection the cDNA of mouse Stx1A (NM_016801.4) ...
-
bioRxiv - Neuroscience 2020Quote: ... splice acceptor-T2A-LexA:QF fragments for all three intron phases were amplified by PCR (Q5 polymerase, New England Biolabs) from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947 ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Cancer Biology 2021Quote: MaTAR20 isoforms were amplified by PCR using Phusion High-Fidelity DNA Polymerase (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... All enzymes and related buffers were purchased from New England Biolabs (NEB, Ipswich, MA, USA) unless otherwise indicated ...
-
bioRxiv - Molecular Biology 2020Quote: ... All enzymes and related buffers were purchased from New England Biolabs (NEB, Ipswich, MA, USA), Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Genetics 2024Quote: ... The B splice form (Spc105RB) was generated using site directed mutagenesis to delete the first intron from the A form (NEB BaseChanger Kit). All mutants were generated using site specific mutagenesis of the A- or B-form Spc105R coding region in the pENTR4 vector ...
-
bioRxiv - Bioengineering 2021Quote: ... All commercially sourced enzymes and related buffers were purchased from New England Biolabs (NEB, Ipswich, MA, USA) unless otherwise indicated ...
-
bioRxiv - Evolutionary Biology 2021Quote: Mutagenesis and related PCR reactions were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, #M0491). The mutant A3G library was constructed via multi-site saturation mutagenesis of codons 128 and 130 using NNS degenerative codons (N = A ...
-
bioRxiv - Biochemistry 2020Quote: ... the amplified DNA and the P4H-TM isoform 1 plasmid were both digested with BlpI (NEB) and XbaI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Cell Biology 2023Quote: ... The CLASP1 isoform was amplified using Q5 Hot Start High- Fidelity DNA Polymerase (New England BioLabs, M0493) with gene specific primers (FW 5’- TCTGGATTTGAATTCCACTATGGAGCCTCGCATGGAG-3’ and RV 5’- TACTGCCATTAGCTGTGCGTGGAGACATCGGAGGA-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... To produce the ABI1 Isoform 2 deleted SH3 domain we performed Q5 site-directed mutagenesis (New England Biolabs Inc.) with forward primer 5’-TAGCTCGAGGTTAACGAATTC - 3’ and reverse primer 5’-TTTCTCAATATAATTCTTGGGG - 3’ synthesized by IDT and then verified the sequence (Genewiz) ...
-
bioRxiv - Microbiology 2022Quote: ... human NINL isoform 2 (NCBI accession NM_001318226.2) and the NINL isoform 2 mutant (Q231R) were mutagenized using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The plasmids encoding 3C proteases (coxsackievirus B3 (CVB3 ...
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Genomics 2022Quote: Poly-A libraries (figure 1 and related data) were constructed with the NEBNext Ultra RNA library prep kit for Illumina (New England Biolabs, Ipswich, USA), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmids for overexpressing the long and short isoforms of HERPUD2 were generated by cloning corresponding sequences into p3×Flag-CMV between the EcoRI and BamHI (NEB, R3136S) restriction sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The bead-bound protein was incubated with 3 µM SNAP-Surface Alexa Fluor 647 (NEB) for 40-60 min at 4°C (to fluorescently label the protein) ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid encoding GFP-labeled dominant negative mutant version of human Rab5B isoform was introduced to plasmid #1008 using Q5 Site-Directed Mutagenisis kit (NEB, Cat# E0554S) according to manufacturer’s instructions using forward primer #1554 (AGTGGGAAAGaacAGCCTGGTATTAC ...
-
bioRxiv - Genomics 2019Quote: ... expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1) expressing ATG7 isoform 1 was derived from pCMV-myc-Atg7(2) using the Q5 site-directed mutagenesis kit (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Physiology 2020Quote: ... and the coding regions of the two isoforms were amplified using Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs, MA, USA) using isoform-specific primers (Supplemental Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of genomic DNA was incubated with 3 µg of in vitro transcribed sgRNAs and 3 µg of purified Cas9 protein in 20µl of 1x NEB3 buffer (New England Biolabs) at 37°C over night ...
-
bioRxiv - Microbiology 2024Quote: ... protein aliquots were subjected to PNGase F or a broad range mannosidase (α1,2/3/6) (New England Biolabs, France) digestion according to the manufacturer’s specifications ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.5 µL of 10X GlycoBuffer 3 (Cat.#B1720S; New England Biolabs) and 2.5 µL of Endo Hf in a total reaction volume of 25 µL ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Dephosphorylated RNA-protein complexes were then rinsed once with NT2 buffer and 3’-end ligated with T4 RNA Ligase 1 (NEB) overnight in an Eppendorf Thermomixer at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... To visualize SNAP-tagged dCENP-A proteins cells were labelled with 3 µM SNAP-Cell TMR Star (New England Biolabs) for 30 min ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Synthetic Biology 2021Quote: 8.3 μM bdSUMO-HSPB611–20 fusion protein containing pSer or nhpSer at site S16 of HSPB6 were reacted with 3 units of λ phosphatase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...