Labshake search
Citations for New England Biolabs :
1 - 37 of 37 citations for p5 Ligand for Dnak and and DnaJ since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: SNAP-tag ligands (NEB): SNAP-Cell TMR-star ...
-
bioRxiv - Neuroscience 2022Quote: ... SNAP-ligand TMR-Star (NEB) or SNAP-surface-Alexa488 (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were labelled with 100 nM Halo-TMR ligand and 100 nM SNAP-Cell 647-SiR ligand (New England Biolabs) for 20 min ...
-
bioRxiv - Biophysics 2022Quote: ... and 0.12 µM SiR-SNAP-Tag ligand (NEB, S9102S) for 30 min at 37°C and 5% CO2 ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... SNAP-tag® ligand Blue 430 (New England Biolabs, S9109S) was applied for 30 min at a final concentration of 2 µM ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 μL 25μM P5 adapter and 25 μL NEBNext High-Fidelity 2x PCR Master Mix (NEB). Transposed DNA was amplified for 5 min at 72°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... SYBR™ green and 0.5 µM of sample-specific P5/P7 barcoded primer mix (New England Biolabs). Bead clean-up and purification was performed using SPRI beads (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2022Quote: ... and CLIP-tag ligands (CLIP surface 647 - BC 647 [NEB, S9234S]) at final concentrations of 1 μM in 0.3% PBT ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... P5 adapters were ligated to the ends with 1 μl of 2000 U/μl T4 DNA Ligase (NEB) at 16 °C for 20 hr ...
-
bioRxiv - Molecular Biology 2021Quote: ... the commercially available fluorescent ligand SNAP-Cell TMR-Star (New England Biolabs) was used.
-
bioRxiv - Immunology 2022Quote: ... a 1 in 200 dilution of SNAP-Oregon cell permeable ligand (NEB) was added.
-
bioRxiv - Cancer Biology 2019Quote: ... Barcode cassette was amplified from genomic DNA with primers P5.seq-B-GLI.v1 and P7.seq-B-GLI.v1 using OneTaq® DNA Polymerase (NEB, cat ...
-
bioRxiv - Cell Biology 2020Quote: ... Tagmentation reactions were completely used as input for a first PCR reaction with cassette-and Tn5-adapter-specific primers (5Btn-hmNeong.rv, P5.fw) with NEBNext Q5 HotStart polymerase (New England BioLabs) with 15 cycles of 68 °C and 1 min elongation ...
-
bioRxiv - Cell Biology 2020Quote: ... These beads were then used as input of a second PCR with cassette-and Tn5-adapter-specific primers (P7-gri701…706-hmNeong.rv, P5.fw) with NEBNext Q5 HotStart polymerase (New England BioLabs) with 25 cycles of 68 °C and 1 min elongation ...
-
bioRxiv - Plant Biology 2022Quote: ... and the BioNotI-P5-PET oligo and captured by Dynabeads for end repairing with End Repair Enzyme Mix (NEB) and ligation with barcoded Illumina compatible adapter using T4 DNA Ligase (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... were transfected and incubated with 0.5 µM 647-SiR SNAP ligand (S9102S, NEB) and 0.5 µg/ml Hoechst 34580 in DMEM (11965-092 ...
-
bioRxiv - Microbiology 2022Quote: ... The ORF was removed by inverse PCR to generate the genomic deletion vector (P5/P6) and plasmid recircularized from PCR product (KLD enzyme blend, NEB).
-
bioRxiv - Synthetic Biology 2019Quote: 2 μL of the Dynabeads were used as template for the final PCR using barcoded P5 and P7 primers and Q5 HiFi 2× Master Mix (NEB) + SYBR Green ...
-
bioRxiv - Genomics 2022Quote: PCR templates for in vitro transcription (IVT) were amplified from S2 cell cDNA or pGF-P5(S65T) plasmid using Phusion Hot Start Flex DNA Polymerase (NEB) and primers listed in Supplementary Table 5 ...
-
bioRxiv - Neuroscience 2022Quote: ... The chemical substrates were SNAP- tag ligands (SNAP surface 549 - BG 549 [NEB, S9112S]) and CLIP-tag ligands (CLIP surface 647 - BC 647 [NEB ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of libraries prior to sequencing used qPCR with primers specific to the Illumina P5 and P7 adaptor sequences and standards from the NEBNext Library Quant Kit (NEB, E7630S). Sequencing of prepared libraries was performed using an Illumina MiniSeq with the 75-cycle high-output kit ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCACTGT-3’ (8bp Barcode) and P5 overhang: 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ using Q5 Hot Start High-Fidelity polymerase (NEB, #M0494S) for 21-24 cycles ...
-
bioRxiv - Microbiology 2022Quote: ... A second amplification round was performed with a primer bearing a P5 Illumina sequence and P7 indexed Illumina primers (NEB#E7335S). Primer sequences are available on request ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL of 10 mM indexed P5 and P7 primer solutions and 25 µL NEBnext High-Fidelity 2X Master Mix (New England BioLabs: ME541L) were added ...
-
bioRxiv - Biochemistry 2020Quote: ... The 5’ phosphate of transcribed RNA ligands was removed using calf intestinal phosphatase (CIP, NEB) and then replaced with 32P using T4 polynucleotide kinase (PNK ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with SNAP-tag ligand SNAP-Cell 647-SiR (New England BioLabs; S9102S) at a final concentration of 100 nM for 15 minutes followed by 30-45 minute washout in i3Neuron Maintenance Media before imaging in i3Neuron Imaging Media ...
-
bioRxiv - Microbiology 2022Quote: ... a 20uL 16S-V4 PCR reaction was set up (1ng extracted gDNA; 1uL forward barcoded P5 primer; 1uL reverse barcoded P7 primer; 10uL NEBNext® Ultra™ II Q5® Master Mix [NEB M0544X] ...
-
bioRxiv - Cell Biology 2023Quote: ... Stable transformants were labeled with 100 nM SNAP-Cell 647-SiR ligand (New England Biolabs, S9102S). The fluorescence signals from SNAP-Cell 647-SiR were detected ...
-
bioRxiv - Molecular Biology 2023Quote: ... SNAP-tag coupling activity (methodology described below) was first tested with a small ligand BG-biotin (NEB) or DNA (a 550 bp benzylguanylated PCR product ...
-
bioRxiv - Cancer Biology 2019Quote: MIC ligands and orthogonal variants were cloned by ligation-independent assembly (HiFi DNA Assembly Master Mix, NEB #E2621) as fusions to the C-terminus of either the kappa light-chain or the heavy-chain of human IgG1 antibodies via either an APTSSSGGGGS or GGGS linker ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM dithiothreitol (catalog no ...
-
bioRxiv - Biophysics 2023Quote: ... We then sequentially labeled Nup96 proteins with SNAP ligand conjugated Alexa Fluor 647 (BG-AF647, S9136S, New England Biolabs) and mitochondria with primary anti-Tomm20 antibodies (rabbit polyclonal ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM DTT (catalog no ...
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were labelled both at the surface and intracellularly by addiction of the cell permeable SNAP-Cell 647 SiR ligand (1:1000, New England Biolabs) in DMEM F12 without serum and phenol red (21041-025 ...
-
bioRxiv - Biophysics 2021Quote: ... The SNAP-ligand was covalently attached to the amino-modified staples by mixing the staples and BG-GLA-NHS (NEB, dissolved in DMSO) as previously described (Derr et al ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... and/or SNAP-tag® ligands (Janelia Fluor® 646, provided by Luke Lavis, Janelia; SNAP-Cell® 647-SiR, New England Biolabs, S9102S) were applied for 15 min at a final concentration of 100 nM ...