Labshake search
Citations for New England Biolabs :
1 - 50 of 313 citations for dNTPs since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... dNTPs (NEB), and RNase inhibitor (Fisher Scientific ...
-
bioRxiv - Systems Biology 2020Quote: ... dNTPs (NEB), and RNase inhibitor (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... dNTPs (NEB) and UltraPure™ DNase/RNase-Free water (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... dNTPs (NEB), and UltraPure™ DNase/RNase-Free water (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... dNTP (NEB, N0447) and synthesized 3’-adaptor (see Table 3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and dNTPs (NEB) to make 3’-overhangs and remove 3’-phosphates ...
-
bioRxiv - Cancer Biology 2023Quote: ... 200µM dNTPs (NEB), 1µM forward and reverse primer each and 100 ng of template DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... dNTPs (NEB, N0447L), and the forward primer containing a uracil nucleotide ...
-
bioRxiv - Cell Biology 2023Quote: ... dNTPs (NEB N0447L)
-
bioRxiv - Synthetic Biology 2021Quote: ... and dNTPs (NEB, #N0447S), before being purified using a Qiaquick PCR purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... DNTP mix (Biolabs, 447)) using following primers ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.5 mM dNTPs (NEB), 20 U RNaseOUT (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... 0.2 mM dNTP (NEB), 0.4 μM of each forward and reverse primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1μL 10mM dNTPs (NEB), 1μL 100mM DTT (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM dNTPs (NEB), 0.5 µM forward and reverse primers (IDT) ...
-
bioRxiv - Cancer Biology 2020Quote: ... dNTPs (NEB, Cat: N0447L), RNase inhibitor (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... 1.65 mM dNTP (NEB), 2.2 % (v/ v ...
-
bioRxiv - Microbiology 2020Quote: ... 0.2 μM dNTP (NEB), 0.5 μM of each Fw and Rv primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5mM dNTP (NEB, Cat.No.N0447) and 0.48% Triton X-100 (Sigma ...
-
bioRxiv - Biophysics 2019Quote: ... dNTPs (0.2 mM, NEB) and Taq DNA polymerase (1.25 units ...
-
bioRxiv - Genomics 2021Quote: ... 8uL dNTP (NEB, N0447), 6uL 100mM MgSO4 (Lucigen ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Genomics 2022Quote: ... 1 mM dNTPs (NEB), 1 U/μL RNase Inhibitor (NxGen ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10uL dNTP (10mM) (NEB), 2.5uL KEB.E74 (100uM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 200 μM dNTPs (NEB), 1X Phusion® Buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 200 μM dNTPs (NEB), 1X Phusion® Buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 1×Phusion HF Reaction Buffer (NEB),0.2 mM dNTPs (NEB), 40 U/ml Phusion HF DNA Polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 µM dNTPs (NEB), 0.5 µM forward primer ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM dNTPs (NEB), 20 U RNaseOUT (Invitrogen) ...
-
bioRxiv - Genomics 2023Quote: ... dNTPs (NEB, Cat: N0447L), RNase inhibitor (Life Technologies ...
-
bioRxiv - Physiology 2024Quote: ... 1mM dNTPs (N0477L, NEB), RNase inhibitor (30281 ...
-
bioRxiv - Physiology 2024Quote: ... 1mM dNTPs (N0477, NEB), Klenow Fragment (M0212 ...
-
bioRxiv - Cell Biology 2023Quote: ... and dNTPs (NEB N0447L) to create complementary DNA (cDNA) ...
-
bioRxiv - Genomics 2019Quote: ... 1μl dNTPs 10mM (NEB, #N0447S), 2μl DTT 0.1M (Takara ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.2 mM dNTPs (NEB, #N0447S), 40 U/ml Phusion HF DNA polymerase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 0.625mM each dNTP Mixture (NEB), 40 pmol 2nd-NSRs ...
-
bioRxiv - Immunology 2021Quote: ... 625 nM dNTP Mixture (NEB), 25 μM 2nd NSR primers ...
-
bioRxiv - Neuroscience 2020Quote: ... 1µl dNTPs 10mM (NEB, #N0447S), 2µl DTT 0.1M (Takara ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 400 µM dNTP (NEB) with incubation at 30°C for 30 min ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 μl dNTP mix (NEB), 0.2 μl MgCl2 ...
-
bioRxiv - Genomics 2021Quote: ... 1µL 10mM dNTP (NEB N0447L), 1µL Klenow 3’->5’ exo- (50U/µL ...
-
bioRxiv - Genomics 2021Quote: ... supplemented with dNTPs (NEB, N0447L) at a final concentration of 400 μM each and 2.5 mM EGTA ...
-
bioRxiv - Genomics 2020Quote: ... 0.23μl 10 mM dNTPs (NEB), 0.08 μl 10 U/μl E ...
-
bioRxiv - Microbiology 2021Quote: ... 250 μM dNTPs (NEB N0447L), 2 μM universal 16S reverse primer 786R ...
-
bioRxiv - Plant Biology 2022Quote: ... dNTPs (New England Biolabs, N0447S). Fluorescent Brightener 28 disodium salt solution (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μM each dNTP (NEB), 1 U Phusion DNA polymerase (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... dNTP (New England Biolabs, N0447S), hypoxanthine (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... dNTPs (N0447S, New England BioLabs), RNAse inhibitor (M0314L ...
-
bioRxiv - Physiology 2023Quote: ... 2.5 mM dNTPs (N0446, NEB) and RNase inhibitors (M0314 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM dNTPs (NEB - N0446S), 1.2 units SUPERaseIN Rnase Inhibitor (Thermo Fisher – AM2696) ...