Labshake search
Citations for New England Biolabs :
1 - 50 of 2949 citations for Urotensin II Related Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Cloning related enzymes were purchased from New England Biolabs (NEB). Zyppy™ Plasmid Miniprep kit and DNA Clean & Concentrator™ kit were purchased from Zymo Research ...
-
bioRxiv - Molecular Biology 2020Quote: ... All enzymes and related buffers were purchased from New England Biolabs (NEB, Ipswich, MA, USA) unless otherwise indicated ...
-
bioRxiv - Molecular Biology 2020Quote: ... All enzymes and related buffers were purchased from New England Biolabs (NEB, Ipswich, MA, USA), Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2021Quote: ... All commercially sourced enzymes and related buffers were purchased from New England Biolabs (NEB, Ipswich, MA, USA) unless otherwise indicated ...
-
bioRxiv - Evolutionary Biology 2021Quote: Mutagenesis and related PCR reactions were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, #M0491). The mutant A3G library was constructed via multi-site saturation mutagenesis of codons 128 and 130 using NNS degenerative codons (N = A ...
-
bioRxiv - Plant Biology 2023Quote: ... and AT1G66100 which encode a PR (pathogenesis-related) protein were amplified using the Phusion High-Fidelity DNA Polymerase (New England Biolabs) from Col-0 genomic DNA with two primer pairs RBCS2B-BglII-PF (5′-CCAGATCTGGAATATTCAATGTTGACTATC-3′ ...
-
bioRxiv - Genomics 2022Quote: Poly-A libraries (figure 1 and related data) were constructed with the NEBNext Ultra RNA library prep kit for Illumina (New England Biolabs, Ipswich, USA), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Three peptide phage libraries from NEB “New England Biolabs” ...
-
bioRxiv - Plant Biology 2024Quote: ... when OD600 reached 0.5 for 4 h at 37 °C and then they were purified using amylose resin column (New England Biolabs, for MBP related proteins purification) or Ni-NTA agarose column (Qiagen ...
-
bioRxiv - Systems Biology 2022Quote: ... Protoscript II and Protoscript II Reaction Buffer (NEB, M0368L) as well as murine RNase-Inhibitor (NEB ...
-
bioRxiv - Genomics 2021Quote: ... ProtoScript II (NEB), and 1 μg input of total RNA ...
-
bioRxiv - Microbiology 2023Quote: ... Protoscript II (NEB) and 0.1M DTT ...
-
bioRxiv - Microbiology 2022Quote: ... Peptide-N-Glycosidase F (PNGase F; NEB, P0704) treatment of lysates was performed as described in the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2019Quote: ... Protoscript II (NEB, MA) first strand cDNA synthesis kit was used to prepare cDNA from 1 µg of RNA ...
-
bioRxiv - Microbiology 2021Quote: ... ProtoScript II (200units, NEB) and DTT (5mM) ...
-
bioRxiv - Biochemistry 2020Quote: ... heparinase II (NEB #P0736), and chondroitinase ABC (Sigma-Aldrich #C3667 ...
-
bioRxiv - Neuroscience 2021Quote: The ProtoScript II (NEB) reverse transcription system was used to create cDNA from RNA samples ...
-
bioRxiv - Cell Biology 2021Quote: ... or ProtoScript II (NEB). Quantitative real-time PCR was run using SYBR green on a CFX Connect system (Biorad) ...
-
bioRxiv - Cell Biology 2023Quote: ... heparinase II (NEB, P0736S) and heparinase III (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Peptide-N-glycosidase F (PNGase F) (New England BioLabs) was used to remove all N-linked oligosaccharides for 1 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... or for peptide N-glycosidase F (PNGase-F, NEB) digestion using 500 units PNGase-F for 1,5h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... and Protoscript II RT (NEB). 10 μl of cDNA was PCR amplified for 18 cycles with Illumina TruSeq primers and Phusion DNA polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... and 200U Protoscript II (NEB). cDNAs were circularized using 100U CircLigase I ssDNA ligase (Epicentre) ...
-
bioRxiv - Genomics 2021Quote: ... NEB Ultra II (NEB, 7645S) reagents were used following the manufacturer’s protocol with the following deviations ...
-
bioRxiv - Genomics 2021Quote: ... while ProtoScript II (NEB Biolabs) was used for the Twist Bioscience workflow according to the details given in the Twist Bioscience Library Preparation protocol ...
-
bioRxiv - Genomics 2021Quote: ... while ProtoScript II (NEB Biolabs) was used for the Twist Bioscience workflow according to the details given in the Twist Bioscience Library Preparation protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... ii) 500U Endo H (NEB), or iii ...
-
bioRxiv - Molecular Biology 2022Quote: ... ProtoScript II (New England Biolabs), Recombinant HIV (Worthington ...
-
bioRxiv - Microbiology 2023Quote: ... Protoscript II (New England Biolabs) was used to reverse transcribe RNA into cDNA as template for qPCR analysis using the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein Deglycosylation Mix II (NEB) was added and further incubated for 30 min ...
-
bioRxiv - Bioengineering 2024Quote: ... deglycosylation mix II (P6044S NEB) was obtained from New England Biolabs (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... and tryptic peptides were generated using Trypsin-Ultra (P8101S, NEB) following the protocol described previously2 ...
-
bioRxiv - Neuroscience 2022Quote: ... or peptide N-glycanase (PNGase, New England Biolabs, 1,000 units) for 6 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of peptide N-glycosidase F (New England Biolabs) were added ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2uL of SuperScript II (NEB M0368L), and 2 uL of water ...
-
bioRxiv - Genomics 2020Quote: ... 0.75 µl Protoscript II (150U; NEB)] at 50°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Type IIs RE (0.5 μl, NEB), vector backbone and inserts were combined to make 10 μl ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcribed using Protoscript II (NEB), and quantified using qPCR with primers for renilla luciferase (forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Protoscript II (New England Biolabs) reverse transcriptase ...
-
bioRxiv - Genomics 2019Quote: ... and 20 Units CviA II (NEB) at 25°C for 20 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... reverse transcribed using protoscript II (NEB) and RT primer oBZ408 (/5Phos/RNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSP18/TTC AGACGTGTGCTCTTCCGATCTGTCCTTGGTGCCCGAGTG) ...
-
bioRxiv - Bioengineering 2019Quote: ... isothermal buffer II (NEB, Ipswich, MA), betaine (Millipore Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 units/ml Dpn II (NEB) in RE buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... ProtoScript II reverse transcriptase from NEB was used to generate cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... then USER II enzyme (NEB, M5509) was added to cleave the product followed by a second column purification (Zymo research ...
-
bioRxiv - Biochemistry 2023Quote: ... pomatia RNA with Protoscript II (NEB) and random primers ...
-
bioRxiv - Immunology 2020Quote: ... The peptides were first digested with Endo H (New England Biolabs) to deplete oligomannose- and hybrid-type glycans and leave a single GlcNAc residue at the corresponding site ...
-
bioRxiv - Bioengineering 2020Quote: ... reesei strain by peptide N-glycosidase F (PNGase F, NEB, P0704) (Wang et al ...