Labshake search
Citations for New England Biolabs :
1 - 50 of 5851 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: All bacterial two-hybrid plasmids were constructed using the Gibson assembly mix (NEB) or the Hifi DNA assembly mix (NEB) ...
-
bioRxiv - Genetics 2023Quote: Plasmids for yeast two-hybrid experiments were constructed using NEBuilder DNA assembly (NEB), Ligation High kit (TOYOBO) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and dlk-1a were cloned into the two-hybrid vectors using HiFi Assembly (NEB).
-
bioRxiv - Genomics 2024Quote: ... Two genomic library protocols were prepared for each (NEB and iNextEra ...
-
bioRxiv - Pathology 2023Quote: ... was ligated to the RNA-cDNA hybrid complex using T4 DNA Ligase (NEB M0202L) and subsequently purified with the Agencourt RNAClean XP beads (Beckman-Coulter ...
-
bioRxiv - Systems Biology 2022Quote: ... before cDNA library preparation using NEBNext Ultra RNA Library Prep (NEB). GENEWIZ sequenced the libraries on Illumina HiSeq ...
-
bioRxiv - Genetics 2020Quote: ... pREP81-FLAG vector and plasmids carrying wild type and mutated forms of rrp1+ and rrp2+ as well as domains of rrp1+ gene used in the yeast two hybrid system were constructed using the Gibson Assembly® Cloning Kit (NEB). All primers used to amplify gene sequences by PCR are listed in Table S3 ...
-
bioRxiv - Cell Biology 2022Quote: ... and CUT&RUN samples from two replicate (two independent CRISPRi clones) using NEBNext Ultra II DNA Library Prep Kit for Illumina (E7645, NEB). The manufacture’s protocol was employed with the following changes ...
-
bioRxiv - Physiology 2020Quote: ... then used for cDNA library synthesis (NEB E6560). Full-length sequence for a Nematostella calcium channel beta subunit was obtained with a RACE strategy using specific primers (GATTACGCCAAGCTTTATGCGTCCAATCGTA CTTGTCGGC and GATTACGCCAAGCTTGCCGACAAGTACGATT GGACGCATA ...
-
bioRxiv - Genetics 2019Quote: ... and cDNA libraries were prepared using the Directional RNA Library Prep Kit (NEB). Paired end sequencing was done on a NoaSeq 6000 ...
-
bioRxiv - Immunology 2022Quote: ... cDNA libraries were prepared using NEBNext Ultra DNA library kits (New England BioLabs) for Illumina ...
-
bioRxiv - Plant Biology 2023Quote: ... Preparation of RNA library (non-directional 250∼300 bp insert cDNA library (NEB)) and transcriptome sequencing (Illumina Novaseq 6000 paired-end 150 ...
-
bioRxiv - Immunology 2021Quote: ... cDNA library was prepared using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) and sequenced on NextSeq 500 System (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... cDNA library preparation was done using NEBNext stranded library preparation protocol (New England Biolabs) with rRNA depletion using the QIAseq FastSelect rRNA HMR kit ...
-
bioRxiv - Microbiology 2023Quote: cDNA libraries were prepared using a NEBNext Ultra II RNA Library Prep Kit (NEB). RNA and cDNA quality and quantity were evaluated by performing a Qubit assay with the TapeStation 4200 system (Agilent Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was amplified in two rounds of PCR using Q5 high-fidelity polymerase (NEB). Adapters necessary for sequencing on the Illumina platform were introduced with the KAPA HyperPrep kit (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA libraries were prepared using NEBNext Ultra Directional RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA libraries were constructed using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA libraries were constructed using NEB next ultra-directional library kit (New England Biolabs Inc) and sequencing was performed using the Illumina HiSeq X platform ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA libraries were constructed using the NEBNext Ultra RNA Library Prep Kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... the cDNA library is constructed using the NEBNext Ultra II RNA Library Prep Kit (NEB) as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... The cDNA libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) and RNA was sequenced using the Illumina Novaseq PE150 platform.
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were constructed using the NEBNext Small RNA Library Prep Set for Illumina (NEB) with 14 PCR amplification cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... Frozen RNA was sent for cDNA library preparation (using NEB Next® Ultra RNA Library Prep Kit for Illumina ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... muelleri cDNA library using Phusion High-Fidelity DNA polymerase (NEB). Primer sequences and amplicons are specified in the Supplement (Supplement) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The resulting cDNA library was amplified using Q5 Polymerase (NEB) and purified for sequencing analysis.
-
bioRxiv - Bioengineering 2023Quote: ... cDNA was prepared according to the manufacturer’s instructions (NEB library) and sequenced using the Illumina platform ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The cDNA library was constructed using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) and 3 μg RNA per sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sequencing-ready cDNA libraries were quantified with the NEBNext library quantification kit for Illumina (NEB). mRNA-seq libraries were sequenced with single-end 50 at ≈20 million reads per sample with biological triplicates ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA libraries were prepared using the NEBNext™ Ultra Directional RNA Library Prep Kit (NEB, USA), the NEBNext Poly(A ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA libraries were generated using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7645) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by cDNA NGS library preparation (NEBNext® Ultra RNA Library Prep Kit for Illumina, NEB). The size of the resulting libraries was controlled by the use of a Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies ...
-
bioRxiv - Immunology 2022Quote: ... then cDNA libraries were generated using a NEBNext Ultra DNA Library Prep Kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: RNA libraries were converted to cDNA libraries using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB) and NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA libraries were prepared using the NEBNext Multiplex Small RNA Library Prep kit for Illumina (NEB) in accordance with the manufacturers’ instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA library preparation using NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB), and sequencing was performed at the Yale Stem Cell Center Genomics Core facility ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA library preparation (NEBNext Ultra II Directional RNA Library Prep Kit - Bacteria (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Diluted cDNA (100-fold) was used for two multiplex PCR reactions with Q5 polymerase (NEB) with two primer pools (Table S5) ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were generated from two PCR reactions both using Q5 High-Fidelity DNA Polymerase (NEB). Primers flanking mutated regions amplified ...
-
bioRxiv - Genomics 2024Quote: ... 1 μg of the step two plasmid library was linearized with SpeI-HF (NEB #R3133) at 37°C for 16 hours ...
-
bioRxiv - Physiology 2020Quote: ... Corresponding cDNA libraries were generated using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB (UK) Ltd. ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) and sequenced on a HiSeq 4000 system (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... cDNA library was prepared with NEBNext Ultra II RNA library prep kit for Illumina (New England Biolabs), and the sequencing carried out using Illumina’s HiSeq-2500 sequencer with single-end mode and read length of 50 bp ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA libraries were constructed with NEBNext® Ultra™ RNA Library Prep Kit (E7530L, NEB, USA), and then sequenced with paired-end sequencing on an IlluminaHiseq4000 (LC Sceiences,USA ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cDNA libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) and cDNA fragments (150 ∼ 200 bp in length ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We prepared cDNA libraries with the NEBNext Ultra RNA Library Prep Kit for Illumina (NewEngland Biolabs, MA) with poly(A ...
-
bioRxiv - Neuroscience 2023Quote: ... the cDNA libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs) and were assessed using Qubit 2.0 fluorometer to calculate the concentrations and Bioanalyzer Instrument to determine insert size ...
-
bioRxiv - Microbiology 2022Quote: ... the cDNA libraries were generated using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB, USA) following manufacture’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was used to make libraries with the NEBNext Ultra II FS Library Preparation Kit (E6177S, NEB), using a five-fold lower reaction volume than instructed by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: cDNA libraries for sequencing were constructed using TruSeq RNA Library Prep Kits for Illumina® (NEB, USA) according to the manufacturer’s instructions ...