Labshake search
Citations for New England Biolabs :
1 - 50 of 1346 citations for Tumor necrosis factor receptor superfamily member 3 LTBR Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: The three NMDAR fusion protein constructs were subcloned into pCSE2.7-mIgG2a-Fc-XP (N1-Fc and N2B-Fc) or pCSE2.8-mIgG2a-Fc-Xp (N1-N2B-Fc) using NcoI/NotI (New England Biolabs, Frankfurt, Germany) for mammalian production in Expi293F cells ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µL factor mix (NEB), 250 nM pre-incubated 50S ribosomal subunits ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL factor mix (NEB), 250 nM pre-incubated 50S ribosomal subunits ...
-
bioRxiv - Cancer Biology 2021Quote: Polyadenylated mRNA was isolated from 1 μg of total RNA from cultured tumor cells or excised tumor tissue using NEBNext® Poly(A) mRNA Magnetic Isolation Module (cat. #E7490, New England Biolabs) and the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Factor Xa protease (New England Biolabs) was added to the MT solution at a molar ratio of 1 ...
-
bioRxiv - Plant Biology 2021Quote: ... Factor Xa (P8010S, New England BioLabs) or TEV protease (P8112S ...
-
bioRxiv - Biochemistry 2023Quote: ... 20 µg factor Xa protease (NEB) and 5 mM CaCl2 with inversion at 10 °C overnight ...
-
bioRxiv - Systems Biology 2019Quote: ... immunoprecipitated receptors were deglycosylated with PNGase F (New England Biolabs), before resuspending in LDS sample buffer and running on NuPAGE 4-12% Bis Tris precast gels ...
-
bioRxiv - Cell Biology 2021Quote: All dox-inducible factors were generated by cloning the open reading frame of each factor into the pMINI vector (NEB) and then restricted with EcoRI or MfeI and inserted into the FUW-TetO expression vector ...
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 DNA was extracted and amplified by Q5 High-Fidelity PCR (NEB, M0494S) using primers encompassing the sgRNA recognition site ...
-
bioRxiv - Microbiology 2020Quote: ... the resin was treated with factor Xa protease (P8010L, NEB) overnight at 4°C ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... the MPB tag was cleaved overnight using Factor Xa (NEB) in dialysis buffer and loaded again on an MBP-Trap HP column ...
-
bioRxiv - Neuroscience 2022Quote: ... Receptor cDNAs were amplified by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs) from cDNA of mixed-stage populations of wild-type C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs). All DNA was sequence verified using Sanger nucleotide sequencing (Retrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... MBP was cleaved from LH using Factor Xa (New England Biolabs) at a w/w ratio of 1% Factor Xa:LH ...
-
bioRxiv - Cell Biology 2021Quote: ... Receptors were surface labelled by addition of Snap-Cell 647 SiR (1:1000, New England Biolabs) to the media for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Mutations were generated in the rat P2X2 receptor using the Q5 Site-Directed Mutagenesis Kit (NEB). Each mutation was verified by DNA sequencing and subcloned in pWPT-EF1α-P2X2-GCaMP6s-IRES-DsRed2 or pWPT-EF1α-P2X2-GCaMP6s-P2A-mScarlet lentiviral vectors.
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of Snap-Cell 647 SiR (1:1000, New England Biolabs) to the media for 20 min ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs). Regularly ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Cat. #E7770) or NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (#E7760) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of SNAP-Surface Alexa Fluor 546 (1:1000, New England Biolabs) to DMEM F12 without serum and phenol red (21041-025 ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Microbiology 2020Quote: ... Appropriate fractions were pooled and digested with factor Xa protease (New England Biolabs) in the presence of 2 mM CaCl2 at 4 °C overnight ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids encoding chimeric SCS6/MLA1 and SCS6/MLA6 receptors were assembled using the NEBuilder HiFi assembly Kit (NEB) based on the domain boundaries reported in (28) ...
-
bioRxiv - Microbiology 2020Quote: The plasmid pAAV S1-Fc was digested with New England Biolabs (NEB) Restriction Enzymes Pvu I-HF (Cat ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Cell Biology 2023Quote: ... the column was loaded with 80 units of Factor Xa (New England Biolabs, P8010) in cleavage buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... activation was performed overnight at 4 °C with 5 μg of Factor Xa (NEB) per mg of protein ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cancer Biology 2019Quote: ... 1 µg of genomic DNA from the tumor was used as input for library preparation using the NEBNext DNA Library Prep Kit (New England Biolabs). DNA was mechanically fragmented to 350 bp (Covaris ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5μg genomic DNA of each tumor was used as template in a pre-amplification reaction using unique barcoded primer combination for each tumor with 20 cycles and Q5 High-Fidelity DNA Polymerase (NEB). The following primers were used:
-
bioRxiv - Cancer Biology 2022Quote: ... 100 ng genomic DNA extracted from tumor samples and cancer cell lines were digested using restriction enzymes NsiI (New England Biolabs), VspI (FastDigest ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Bioengineering 2022Quote: ... Then CaCl2 was added to 2mM and 1 µL (about 1 µg) of Factor Xa (NEB) was added per 50 µg of protein and the samples were left at RT for 20-24h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Customized PURExpress reconstituted systems lacking all amino acids and release factors (Δaa, ΔRF123) (New England Biolabs) (Fig ...