Labshake search
Citations for New England Biolabs :
1 - 49 of 49 citations for TRAP 14 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 14-cycle PCR with index primers (NEB) was performed (initial denaturation ...
-
bioRxiv - Genetics 2019Quote: ... column-purified and transformed in 14 electroporations (NEB 10-beta Electrocompetent E ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was PCR amplified for 14 cycles by using LongAmp Taq (NEB). ONT adaptor ligation was performed using T4 DNA ligase (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 14 PCR cycles using unique dual indexes (New England Biolabs E6440S). Following clean-up with SparQ PureMag beads (QuantaBio) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Genomics 2019Quote: ... and amplified for 14 cycles by NEBNext Ultra II Q5 Master Mix (NEB), NEBNext Universal PCR primer for Illumina (5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC-s-T-3’ ...
-
bioRxiv - Genetics 2021Quote: ... 0.5 μM MPRA_v3_F and MPRA_v3_20I_R primers (Supplementary Table 14) and 2 ng BSA (NEB, B9000). PCR master mix was emulsified by vortexing with 220 μL Tegosoft DEC (Evonik) ...
-
bioRxiv - Cancer Biology 2020Quote: ... extra Biotin-14-dATP was first removed using 15 units of T4 DNA polymerase (NEB) and incubating at 20°C for 4 hours ...
-
bioRxiv - Microbiology 2020Quote: ... 14-17 A260 of lysate was digested with 800 U/A260 of micrococcal nuclease (MNase, NEB) at 25°C with shaking at 14,500 rpm for 20 min in lysis buffer supplemented with 2 mM CaCl2 and 500 U RNase Inhibitor ...
-
bioRxiv - Plant Biology 2020Quote: ... Resulting fragments were amplified for 14 cycles using NEBNext Ultra II PCR protocol (New England BioLabs) and quality was assessed with the Agilent High sensitivity DNA kit ...
-
bioRxiv - Cell Biology 2021Quote: ... 14 μg of sample DNA were digested overnight at 25°C with CviQI restriction enzyme (NEB, R0639L), which cuts outside the region of interest.
-
bioRxiv - Molecular Biology 2024Quote: ... 1.5 ul 10 mM dGTP, 1.5 ul 10 mM dTTP, 37.5 ul 0.4 mM biotin-14-dATP, 40 ul NEB buffer2 ...
-
bioRxiv - Plant Biology 2020Quote: ... The supernatant was collected after a spin at 16000 g for 30 min and incubated with GFP-Trap (Chromtek) or MBP magnetic beads (NEB) for 3 h at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA (1 μg) or TRAP-isolated RNA (200 ng) was subjected to the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB) to isolate mRNA and proceeded directly to double stranded cDNA synthesis ...
-
bioRxiv - Developmental Biology 2020Quote: ... 37.5 μl of 0.4 mM biotin-14-dATP and 10 μl of 5 U/ μl Klenow (NEB, M0210L) were added and mixed by pipetting ...
-
bioRxiv - Genomics 2020Quote: ... 48hr APF TRAP libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, product E7760S) and 10-12 day adult TRAP libraries were prepared with the NEBNext Ultra RNA library Prep Kit for Illumina (NEB ...
-
bioRxiv - Systems Biology 2023Quote: ... To remove any remaining phosphorylation the GFP-Trap bound proteins were treated with 40 units of Lambda Protein Phosphatase (New England Biolabs, P0753S) at 30°C for 30min ...
-
bioRxiv - Genetics 2021Quote: ... Tagmented library was amplified with P5_BRB and BRB_Idx7N5 primers (5 μL, Supplementary Table 14) using NEBNext UltraTM II Q5 Master Mix (NEB, M0544L) which was incubated at 98 °C for 30 sec before adding DNA with the following conditions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with 10–14 cycles of enrichment for each sample and using Phusion High-Fidelity Master Mix (NEB catalog #M0531). Samples were submitted for 101 bp paired-end sequencing on an Illumina HiSeq2000 at BGI-Hong Kong ...
-
bioRxiv - Microbiology 2021Quote: ... First-round PCR of 14 cycles was performed using Q5 High-Fidelity Master Mix (New England BioLabs, Ipswich, MA) and nested gene-specific primers at 20 μM ...
-
bioRxiv - Genomics 2021Quote: DNA ends were marked with biotin-14-dATP by adding 60μL of biotin fill-in master mix (1X NEB 3.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7.5 µL DNA was incubated (14 h, 37°C) with IVT mix (0.5 µL Ribolock inhibitor, Invitrogen, 2 µL T7 polymerase buffer, NEB, 8 µL rNTP mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... The reactions were performed in triplicate for 14 cycles using Q5 Hot Start High-Fidelity 2X Master Mix (NEB), pooled and purified using AMPure XP beads (Beckman Coulter).
-
bioRxiv - Synthetic Biology 2023Quote: ... The lipid film was rehydrated by vortexing with 21 μL rehydration solution (14 μL PURExpress Solution A, 0.875 μL RNase Inhibitor (NEB), 17 μM IGEPAL (90mM) ...
-
bioRxiv - Genomics 2020Quote: ... and 10-12 day adult TRAP libraries were prepared with the NEBNext Ultra RNA library Prep Kit for Illumina (NEB, product E7530S). ChIP-seq libraries were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (NEB ...
-
bioRxiv - Genomics 2020Quote: The isolated total RNA for TRAP libraries underwent poly(A)+ selection using the NEBNext Poly(A) mRNA isolation module (NEB, product E7490S). 48hr APF TRAP libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were produced by PCR amplification (12-14 cycles) of tagmented DNA using the NEB Next High-Fidelity 2x PCR Master Mix (New England Biolabs). Library quality was assessed in an Agilent Bioanalyzer 2100 ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... The DNA samples incubated for primer extension as described previously (14) were treated with dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... was amplified using oAC158/oAC159 and inserted into BamHI digested miniCTX1-optRBS-lacZ (14) using isothermal assembly (Gibson Assembly Master Mix, New England BioLabs). The reactions were transformed into chemically competent DH5α and selected for on tetracycline ...
-
bioRxiv - Developmental Biology 2022Quote: ... and T492 were created through PCR mutagenesis of an intron-less version of pHC329 using the oligonucleotides (#1-14) and HiFi assembly (NEB) (Fig ...
-
bioRxiv - Microbiology 2020Quote: ... Ligation of the product and linearized vector was performed overnight at 14°C with T4 DNA ligase (New England Biolabs). The resulting construct was transformed into DH5α Escherichia coli by heat shock and transformants were obtained by selection on LB agar with carbenicillin and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside ...
-
bioRxiv - Microbiology 2021Quote: ... The 37-mer (50 μM) and the 14-mer (20 μM) RNAs were mixed with Vaccinia Capping Enzyme buffer (NEB), 2 mM SAM ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Microbiology 2022Quote: ... These vectors were generated by mutating the sgRNA site in the pSag1-Cas9-U6-sgUPRT-HXG plasmid [14] using the Q5 Site-Directed Mutagenesis Kit (NEB). The two guide RNAs were designed to target TgEFP1 at either of the predicted EF-hand domains using the online E-CRISP tool (http://www.e-crisp.org/E-CRISP/) ...
-
bioRxiv - Developmental Biology 2022Quote: ... dTTP (250 uM final concentration of each) and 250 uM final concentration of biotin-14-dATP and 50U DNA polymerase I Large (Klenow) Fragment (NEB, M0210) within 1x NEBuffer 3.1 ...
-
bioRxiv - Genetics 2023Quote: ... using a biotin-labeled 30 μM dNTP mix (dATP, dGTP, dTTP and Biotin-14-dCTP Thermo Fischer, 19518018) and Klenow enzyme (NEB, M0210L) at 37°C for 80 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... McGill University) and used to replace the mTurquoise of constructed 14-3-3ζ-mTurquoise using AgeI and NotI-HF (NEB; # R3189S). To conjugate Rluc8 to the N-termini of 14-3-3ζ ...
-
bioRxiv - Genomics 2023Quote: ... and day 14 post-transfection and genomic DNA (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England Biolabs, T3010L). Target regions were amplified by PCR to add barcodes for multiplexing ...
-
bioRxiv - Genetics 2019Quote: ... Exon 14b was amplified with primers F: GACATGTTGCTAAGATTGAAATCCGT from exon 14 and R: GACCCAGCTTTCAGAGTAACCAGAAC from exon 15 using Phusion polymerase (NEB, Ipswich, MA). The longer band containing exon14b was then excised from the gel and purified using Zymoclean gel DNA recovery kit (Zymoresearch ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Unique barcoded adaptor sequences were ligated to each sample of tagmented gDNA with 14 cycles of PCR using OneTaq 2x Master Mix (NEB, cat# M0482S), and all samples were pooled into a single multiplexed sequencing library ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted using TRIzol from 14 d old seedlings and poly(A) enriched before library preparation (NEB E7490 and E7765). Libraries were sequenced on Illumina Hiseq 2500 in a 2×100 bp format ...
-
bioRxiv - Synthetic Biology 2022Quote: In vitro transcription/translation by codon skipping of the short FLAG tag-containing peptides X-Val-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (XV-Flag) where X = 7, 13, 14, or 15 was carried out using the PURExpress® Δ (aa, tRNA) Kit (New England Biolabs, E6840S) based on a previous protocol with slight modifications 16 ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were PCR-amplified for 14 cycles and samples-specific dual indices (“NEBNext Multiplex Oligos for Illumina®”, E7600; New England BioLabs, Ipswich, USA) were attached to the fragments.
-
bioRxiv - Cell Biology 2020Quote: ... supernatant was discarded and fill-in mix was added (38 μM Biotin-14-dATP [Thermo Fisher Scientific], 38 μM dCTP, dGTP and dCTP [Thermo Fisher Scientific], 50 U Klenow Polymerase [NEB], 1x NEB 2 buffer) and cells incubated for 1 h at 37 °C under rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... nuclei were spun down and resuspended in fill-in mix (biotin-14-dATP [Thermo Fisher Scientific], dCTP, dGTP and dTTP [Thermo Fisher Scientific], Klenow Polymerase [NEB], 1x NEB 2 buffer) for 1.5 h at 37°C with rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... nuclei were spun down and resuspended in fill-in mix (biotin-14-dATP [Thermo Fisher Scientific], dCTP, dGTP and dTTP [Thermo Fisher Scientific], Klenow Polymerase [NEB], 1x NEB 2 buffer) for 1.5 h at 37°C with rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... supernatant was discarded and fill-in mix was added (38 μM Biotin-14-dATP [Thermo Fisher Scientific], 38 μM dCTP, dGTP and dCTP [Thermo Fisher Scientific], 50 U Klenow Polymerase [NEB], 1x NEB 2 buffer) and cells incubated for 1 h at 37 °C under rotation ...