Labshake search
Citations for New England Biolabs :
1 - 36 of 36 citations for TM 25659 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
CRISPR-Cas9-mediated knockout of CYP79D1 and CYP79D2 in cassava attenuates toxic cyanogen productionbioRxiv - Plant Biology 2021Quote: ... The TD-PCR protocol began with an annealing temperature of Tm + 10 °C for the first cycling phase (Tm calculated by NEB Tm Calculator tool). The annealing temperature was then decreased by 1 °C per cycle until the primers’ Tm was reached ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Primers were ordered from IDT with Q5 Tms (calculated via the NEB Tm calculator) of 70-72 degrees ...
-
bioRxiv - Genetics 2023Quote: ... We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles, Tm 65 °C). We then performed a bead cleanup ...
-
bioRxiv - Synthetic Biology 2021Quote: ... NEB Tm calculator (tmcalculator.neb.com, New England Biolabs, Ipswitch, MA). The loci targeted for deletion were genotyped using colony PCR with primers that bind to the 5’ upstream and 3’ downstream regions adjacent to the targeted open reading frame (Table S5) ...
-
bioRxiv - Molecular Biology 2023Quote: Sequence libraries were prepared using the NEBNext® Ultra TM RNA Illumina® (NEB, USA) Library Prep Kit ...
-
bioRxiv - Biochemistry 2020Quote: ... the amplified DNA and the P4H-TM isoform 1 plasmid were both digested with BlpI (NEB) and XbaI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were generated using NEBNext Ultra TM RNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were generated using NEBNext® Ultra(tm) DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample.
-
Small Molecule Screen Identifies Pyrimethamine as an Inhibitor of NRF2-driven Esophageal HyperplasiabioRxiv - Cancer Biology 2022Quote: ... Sequencing libraries were generated using NEBNext Ultra TM RNA Library Prep Kit for Illumina (NEB, Ipswich, MA) following the manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tm or EPEC FliCD0 constructs were generated with the Q5 site-directed mutagenesis kit (New England Biolabs) following manufacturer recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were created using NEBNext® Ultra(tm) Directional RNA Library Prep Kit (New England BioLabs, Frankfurt, Germany). Pooled libraries were loaded on the cBot (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Cell Biology 2022Quote: ... then libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2021Quote: ... sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... for mRNA purification followed by a NEBNext® Ultra(tm) II Directional RNA Library Prep Kit (New England BioLabs) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2019Quote: ... The second round PCRs were performed with NEBNext® Ultra(tm) II Q5® Master Mix (NEB, cat. M0544). Amplified samples were purified with AMPure XP SPRI beads (Beckman Coulter ...
-
bioRxiv - Genomics 2022Quote: ... using NEBNext® Ultra(tm) II FS DNA Library Prep Kit for Illumina (New England Biolabs, Cat. No. E7805), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: All plasmids were linearized with NotI and transcribed in vitro using the HiScribe(tm) T7 ARCA mRNA kit (NEB). mRNA was purified using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNA libraries were prepared using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s protocols ...
-
bioRxiv - Genetics 2023Quote: ... Barcodes were amplified by PCR (CP21.P14: TCCTCATCCTCTCCCACATC, CP17.P12: GGACGAGGCAAGCTAAACAG, NEB Q5 for 20 cycles, Tm 67 °C). We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles ...
-
bioRxiv - Biochemistry 2019Quote: ... fused to the 3’ end of the nucleotide sequence encoding full length Ypt7 was amplified by PCR from pET-19 Ypt7-tm (a kind gift from C Ungermann) with the Phusion high-fidelity DNA polymerase (NEB). The DNA fragment was cloned into BamHI and SalI digested pMBP-parallel1 vector (Sheffield et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... was expressed as maltose-binding protein-tagged fusion protein using the pMAL(tm)c5X-vector (New England Biolabs, Ipswich, USA). The coding DNA sequence was amplified by PCR using gene-specific primers (for primer sequences ...
-
bioRxiv - Molecular Biology 2019Quote: Sequencing libraries were prepared using NEBNext® Fast DNA Library Prep Set for Ion Torrent(tm) Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing library was generated using NEB Next® Ultra TM DNA Library Prep Kit for Illumina (NEB, USA, Catalog#: E7370L) following manufacturer’s recommendations and index codes were added to each sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The library of each sample was prepared separately with the NEBNext® Ultra (tm) II FS DNA Library Preparation Kit and the Unique Dual Indexing kit (New England Biolabs), with reagent volumes reduced to one-fifteenth of that advised by the manufacturer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNA was diluted 1/8 in nuclease-free water and used as template for a first touch-down RT-PCR reaction primed with a high-specificity primer (71°C annealing Tm) and a universal reverse primer using Q5 High-Fidelity polymerase (New England Biolabs, USA). The PCR product of this first RT-PCR was then diluted 1/100 in nuclease-free water and used as a template for a semi-nested RT-PCR using a gene-specific primer and the universal reverse primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and libraries for next-generation sequencing were prepared using the NEBNext Ultra(tm) II Directional RNA Library Prep kit with Sample Purification Beads (NEB, E7765S). Libraries were indexed using NEBNext Multiplex Oligos for Illumina Index Primers Set 1 and 2 (E7335S and E7500S) ...
-
bioRxiv - Genetics 2023Quote: ... which adds homology arms and YL_randBCs_R1_3’ which adds random 11 nt barcodes and downstream homology arms (NEB Q5 polymerase Tm=70C). The PCR product was pooled and cleaned using the Monarch PCR and DNA kit ...
-
bioRxiv - Plant Biology 2024Quote: cDNA libraries with different insert sizes were constructed using the NEB Next Ultra TM Directional RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations and were assessed on an Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Cancer Biology 2021Quote: ... The resulting polyA-selected RNA was used to prepare RNA-seq libraries using the NEBNext® Ultra(tm) II Directional RNA Library Prep Kit for Illumina® (cat. #E7600, New England Biolabs), NEBNext® Multiplex Oligos for Illumina® Dual Index Primers Set 1 (cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA libraries were constructed using the NEBNext® Ultra(tm) II Directional RNA Library Prep Kit (New England Biolabs, Inc., Massachusetts, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... One µg total RNA/per isolate was used as input for generation of sequencing libraries using NEBNext®Ultra-TM RNA Library-Prep (Cat#E7770, NEB, Ipswich, USA) following manufacturer’s recommendations (Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2022Quote: ... with the aid of online IDT Oligo Analyzer Tool (Integrated DNA Technologies, Inc., Coralville, USA) and NEB Tm Calculator (New England Biolabs Inc., Ipswich, Massachusetts, USA) to amplify the full-length coding region ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Genomic libraries were prepared using the NEBNext® Ultra TM II DNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, MA, United States) using reagents at half volumes following Hale et al ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...