Labshake search
Citations for New England Biolabs :
1 - 50 of 126 citations for TET 830 modified since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... EF1a-Tet-On3G-2A-BlastR or EF1a-Tet-On3G-2A-nucTomato using Phusion polymerase (NEB) amplified PCR products from existing plasmids ...
-
bioRxiv - Genomics 2024Quote: ... Tet-puro-pLKO plasmid was digested with AgeI and EcoRI (NEB) restriction enzymes ...
-
bioRxiv - Molecular Biology 2021Quote: ... shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system) were cut with EcoRI and XhoI (New England Biolabs). Backbone was purified from agarose gel with QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... ompT lacZ::T7.1 gal sulA11 ∆(mcrC-mrr) 114::IS10 R(mcr-73::)miniTN10(TetS) endA1 [dcm]) (New England Biolabs) was used for protein expression and purification.
-
bioRxiv - Cell Biology 2023Quote: ... a sequence encoding mCherry was added on one side of the tet-inducible bi-directional promoter by conventional restriction cloning (BamHI & SpeI; New England Biolabs). The coding region of a human F-box domain (215 amino acids [aa] ...
-
bioRxiv - Cell Biology 2023Quote: HPV-E6/E7 genomic DNA was subcloned into a pLVX-Tight-Puro backbone (a gift from Genmedic, China) downstream of the Tet operator by the restriction enzyme cutting site EcoRI (NEB) and BamHI (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were propagated in Escherichia coli NEB Turbo ((F’ proA+B+ lacIq ΔlacZM15/fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10) TetS endA1 thi-1 Δ(hsdS-mcrB)5)) (New England Biolabs) at 37°C in lysogeny broth (LB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a modified pGGA vector (New England Biolabs, USA) containing a red fluorescent protein and carrying chloramphenicol resistance gene was used for facilitating the screening of positive bacterial transformants [32] ...
-
bioRxiv - Cell Biology 2021Quote: ... m6A-modified RNA spike-in controls (New England Biolabs) and a nontargeted region on the crRNA-targeted transcript ...
-
bioRxiv - Cell Biology 2021Quote: ... with a destination vector modified from pMAL-c2 (NEB) by insertion of the Gateway cassette (ThermoFisher ...
-
bioRxiv - Zoology 2022Quote: ... Synthesized RNA was modified by Vaccinia Capping System (NEB), mRNA cap 2’-O-methyltransferase (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... The modified RNA was subsequently column-purified (NEB # T2030), 2 pmol were digested to single nucleosides using the Nucleoside Digestion Mix (NEB # M0649) ...
-
bioRxiv - Microbiology 2019Quote: ... and then modified using T4 Polynucleotide Kinase (New England Biolabs), which removes the 3’-phosphate and adds 5’-phosphates ...
-
bioRxiv - Cell Biology 2021Quote: ... The m6A-modified and unmodified control RNAs (New England Biolabs) were divided into fragmented RNA ...
-
bioRxiv - Microbiology 2021Quote: ... was modified using the Q5 Site-Directed Mutagenesis Kit (NEB) so that the gRNA sequence was replaced with two restriction enzyme sites (sequence ...
-
bioRxiv - Synthetic Biology 2020Quote: ... facilitated by expression in a modified pMal-p4x vector (NEB), pSHT18 ...
-
bioRxiv - Cancer Biology 2023Quote: ... constructs were modified using Q5® site-directed mutagenesis (NEB) to remove either the 4-1BB costimulatory domain (TNFRSF8-CD3ζ ...
-
bioRxiv - Molecular Biology 2019Quote: ... pGP was modified from a commercially available plasmid pCMV-Gluc (NEB), in which contains a set of cellular 5’-noncoding sequences (41 nts ...
-
bioRxiv - Microbiology 2021Quote: ... This plasmid was further modified using Q5 Site Directed Mutagenesis (NEB) to add the custom adaptors ACACTCTTTCCCTACACGACGCTCTTCCGATCT and GATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5μg of the modified BACs was linearized with PI-SceI (NEB) and electroporated into 3×106 mESCs ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid constructs were modified by site-directed mutagenesis (E0554; New England Biolabs) to create the desired mutations in klp-6 and cwp-4 ...
-
bioRxiv - Biochemistry 2020Quote: ... into a modified pMAL2c parent vector (New England Biolabs, Ipswich, MA, USA). The modified vector had a TEV MBP cleavable fusion and a modified MCS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Evolutionary Biology 2019Quote: Modified pGL4 luciferase constructs were generated via Gibson cloning (New England Biolabs) to contain an 1826 bp oligo corresponding to region of interest in CECR5/HDHD5 with variants corresponding to a European reference (EUR-EUR) ...
-
bioRxiv - Biophysics 2022Quote: ... and Pat1 were cloned into a modified pMAL plasmid (New England Biolabs) using standard methods and NdeI and BamHI restriction sites ...
-
bioRxiv - Systems Biology 2022Quote: CAM-modified tryptic digest of bovine serum albumin (New England BioLabs Inc.) was labeled with dimethyl using the in-solution labeling protocol (Boersema et al ...
-
bioRxiv - Microbiology 2019Quote: ... Two different modified polymerase enzymes were evaluated for this method: Hemo KlenTaq (NEB) and Phusion Blood Direct (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2021Quote: ... and assembled into modified pET28 vectors by NEBuilder HiFi DNA assembly (E2621, NEB). We created 2 bacterial expression vectors ...
-
bioRxiv - Genetics 2019Quote: ... alba3 sequence was modified by Q5® Site-Directed Mutagenesis (New England Biolabs), according to manufacturer instructions ...
-
bioRxiv - Biophysics 2023Quote: ... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... The biotin-modified DNA was digested using a KasI restriction enzyme (NEB #R0544S) that produced two fragments of 24 kb and 24.5 kb ...
-
bioRxiv - Biochemistry 2023Quote: ... the plasmid above was modified using the Q5 Site-Directed Mutagenesis Kit (NEB) along with the following primers ...
-
bioRxiv - Genomics 2020Quote: ... RNA-seq libraries were prepared using a protocol modified from the NEBNext Ultradirectional (NEB) library preparation protocol to use Barcodes from BIOO Scientific added by ligation ...
-
bioRxiv - Genomics 2022Quote: ... This was modified using the Q5 Site-directed mutagenesis kit (New England Biolabs [NEB]) for domain addition / removal or single amino acid substitutions ...
-
bioRxiv - Genomics 2022Quote: ... This was modified using the Q5 Site-directed mutagenesis kit (New England Biolabs [NEB]) for domain addition / removal or single amino acid substitutions ...
-
bioRxiv - Biochemistry 2023Quote: ... The modified pUC19 target DNA plasmid was linearized by HindIII-HF (New England Biolabs) in advance ...
-
bioRxiv - Biochemistry 2023Quote: ... This plasmid was modified using Q5-site directed mutagenesis (New England Biolabs, Ipswich, MA) to first convert the amber stop codon (TAG ...
-
bioRxiv - Genomics 2024Quote: ... the 5’ end of RNAs were enzymatically modified with RNA 5’ Pyrophosphohydrolase (RppH; NEB) and hydroxyl repair was performed using T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Developmental Biology 2022Quote: ... The pAAV-EF1α-Flpo plasmid70 was modified using the assembly scheme described above (NEB; E5520) to replace the EF1α promoter (removed by MluI/BamHI restriction digestion ...
-
bioRxiv - Microbiology 2019Quote: ... the pSAG1:U6-Cas9:sgUPRT vector [60] was modified by Q5 site-directed mutagenesis (NEB) to specify sgRNAs targeting ROP17 (F2) ...
-
bioRxiv - Biochemistry 2022Quote: ... 29 μl of purified modified RNA was added to 100 ng Random Primer 9 (NEB) and 0.2 mM of each dNTP ...
-
bioRxiv - Plant Biology 2019Quote: ... The modified vector was digested with restriction enzymes HindIII and PstI (New England Biolabs, USA) and amplified product was cloned using In-Fusion HD Cloning Kit (Clontech ...
-
bioRxiv - Microbiology 2019Quote: ... the pSAG1:U6-Cas9:sgUPRT vector (32) was modified by Q5 site-directed mutagenesis (NEB) to specify a sgRNA targeting TGGT1_239010 ...
-
bioRxiv - Biophysics 2023Quote: Kap114 was cloned into two modified vectors: pGEX-4T3 (Cytiva) and pMalE (New England BioLabs). pGEX-4T3 was modified to insert a TEV cleavage site between the GST tag and Kap114 whereas pMalE was modified to insert a His6-tag immediately N-terminus of MBP and a TEV cleavage site after the MBP ...
-
bioRxiv - Cancer Biology 2021Quote: ... GSE1 coding sequence was modified using the Q5 Site-directed Mutagenesis Kit (E0554S, New England Biolabs) to substitute the cytosine (C ...
-
bioRxiv - Neuroscience 2020Quote: Illumina compatible libraries were made from Visium derived cDNA using a modified protocol derived from NEB Ultra II DNA FS kit (NEB #E6177) ...
-
bioRxiv - Microbiology 2021Quote: ... two constructs (Fig. 1A) were made using a modified pgRNA-bacteria plasmid (NEB, Addgene plasmid # 44251). This plasmid ...
-
bioRxiv - Genomics 2021Quote: ... synthesized and modified by Sangon Biotech) and 400 U T4 DNA ligase (New England Biolabs, M0202S) were added to a final volume of 40 μl in 1×T4 DNA Ligase reaction buffer ...
-
bioRxiv - Molecular Biology 2023Quote: Genetically modified zebrafish lines were created using Cas9 protein (EnGen® Spy Cas9 NLS, #M0646T, NEB) and previously established protocols combining PCR and reverse transcription to generate guide RNAs44 ...
-
bioRxiv - Cancer Biology 2023Quote: ... TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...