Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for TBARS MDA Universal Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Bioengineering 2020Quote: ... The RT-PCR detection was conducted by using the Luna Universal One-Step RT-qPCR kit from NEB and following its protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 100 ng of total RNA was used in the detection and quantification of TgCPDH transcripts using the Luna Universal One-Step RT-PCR kit (NEB). Data acquisition was collected using the BioRad CFX96 Touch Real-Time PCR detection system ...
-
bioRxiv - Microbiology 2020Quote: The real-time PCR technique was performed for NDV detection using Luna Universal One-Step RT-qPCR Kit E3005E (New England BioLabs, USA) following the manufacture procedures ...
-
bioRxiv - Microbiology 2021Quote: ... mixtures for the detection of viral RNA were made by a Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs, USA) in accordance with the manufacturer’s instructions and then placed in a thermocycler (BIO-RAD CFX96™ Real-Time System ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 viral RNA detection and quantification was performed using the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs, Whitby, ON, Canada) on the Rotor-gene Q platform (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Genetics 2023Quote: ... 5μL of 2× Luna Universal qPCR Master Mix (NEB, MA, USA). The amplification program was set as follows ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified using the Luna Universal Probe Onestep RT-qPCR kit (New England Biolabs) and US CDC real-time RT-PCR primer/probe sets for 2019-nCoV_N1 ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... or Luna Universal One-Step RT-qPCR Kit (NEB) and 1.5 μl of reference primer/probe sets CDC-N1 (IDT 10006713 ...
-
bioRxiv - Genetics 2020Quote: ... The RNA was then diluted 1:50 and 2 mL were used to perform a one-step qPCR protocol using Luna Universal One-step qPCR kit (NEB). Two primer sets were used ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... Detection of selected targets was performed with Luna® Universal One-Step RT-qPCR (New England BioLabs Inc.) according to manufacturers protocol using specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Physiology 2022Quote: ... EnGen Mutation Detection Kit (New England BioLabs) was used for amplification of target DNA ...
-
bioRxiv - Immunology 2022Quote: ... and Luna® Universal RT-PCR Kit (New England Biolabs) in a StepOnePlus apparatus (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... pipientis infection status by qPCR (NEB Luna Universal qPCR kit) using primer sets for wsp and arm (S1 Table) ...
-
bioRxiv - Biochemistry 2020Quote: ... Luna Universal One-Step RT-qPCR kit (New England Biolabs) was used following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Luna® Universal One-Step RT-qPCR Kit from NEB was used for RT-qPCR reactions ...
-
bioRxiv - Genetics 2023Quote: ... The Luna Universal Probe One-Step RT-qPCR kit (NEB) following the manufacturer’s protocol was used for the quantification of IBV derived RNA using IBV specific primers (forward 5′-GCTTTTGAGCCTAGCGTT-3′ and reverse 5′-GCCATGTTGTCACTGTCTATTG-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Luna Universal One-Step RT-qPCR Kit (NEB), and then analyzed with QuantStudio Design & Analysis Software v.1.5.1 ...
-
bioRxiv - Microbiology 2023Quote: ... and Luna Universal qPCR Master Mix kit (New England Biolabs). Reactions were performed as technical replicates within each of three biological replicates ...
-
bioRxiv - Microbiology 2022Quote: ... We used 2× Luna® Universal qPCR Master Mix (New England Biolabs [NEB]) for quantitative PCR in a volume of 20 µL and primer concentrations of 250 nM each for the forward and reverse primers ...
-
bioRxiv - Microbiology 2022Quote: ... We used 2× Luna® Universal qPCR Master Mix (New England Biolabs [NEB]) for quantitative PCR in a volume of 20 µL and primer concentrations of 250 nM each for the forward and reverse primers ...
-
bioRxiv - Microbiology 2022Quote: ... WarmStart Colorimetric LAMP 2X Master Mix (NEB) was used with 0.4 μM SYTO-9 (Thermo Scientific).
-
bioRxiv - Microbiology 2021Quote: ... The Luna Universal One-Step RT-qPCR Kit (New England Biolabs) was used ...
-
bioRxiv - Systems Biology 2019Quote: ... and the Luna Universal One-Step RT-qPCR Kit (NEB, E3005E) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Primer sequences used are described in Table S2 ...
-
bioRxiv - Biochemistry 2022Quote: ... by Luna Universal One-Step RT-qPCR Kit (New England BioLabs) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and Luna Universal one-step qRT-PCR kit (New England BioLabs) as previously described (13 ...
-
bioRxiv - Systems Biology 2023Quote: ... using the Luna Universal One-Step RT-qPCR Kit (NEB, #E3005). No template and genomic DNA controls were included in all experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, Massachusetts) was used to quantify the RNA samples per the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... The Luna Universal One-Step RT-qPCR Kit (New England Biolabs) was used for the detection of viral genomes in the heat-inactivated samples performed through reverse transcription quantitative polymerase chain reaction (RT-qPCR) ...
-
bioRxiv - Bioengineering 2021Quote: The LAMP reagent mix in a total volume of 25 μL contained 12.5 μL of WarmStart or Colorimetric WarmStart 2 × Master Mix (New England BioLabs) or Bsm polymerase (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... The LAMP reaction in the 2-step LAMP-CRISPR detection was performed using the WarmStart® LAMP Kit (NEB #E1700), using primer concentration described in literature (“Rapid Detection of SARS-CoV-2 Using Reverse transcription RT-LAMP method,” 2020) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: Bead-LAMP using Phenol Red as colorimetric read-out (Figure S5G) was performed with WarmStart colorimetric LAMP 2x master mix (NEB) instead of the HNB containing RT-LAMP mix.
-
bioRxiv - Microbiology 2019Quote: ... and also quantified using NEB Luna Universal qPCR Master Mix and Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA) for qPCR and RT-qPCR test ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the Luna Universal One-Step RT-qPCR kit (New England BioLabs) and primer sets validated in our lab (Supplemental Table 5) ...
-
bioRxiv - Microbiology 2021Quote: ... using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with an in-house developed protocol ...
-
bioRxiv - Microbiology 2020Quote: ... or Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) or LightCycler® Multiplex RNA Virus Master (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and Luna Universal One-Step RT qPCR Master Mix kit (NEB E3005L) and Tween-20 (Sigma-Aldrich P1379) ...