Labshake search
Citations for New England Biolabs :
1 - 50 of 87 citations for Somatostatin 28 Rabbit Polyclonal since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs), or mouse monoclonal anti-β-actin antibody (A5316 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal anti-SNAP-tag (New England BioLabs, P9310S), mouse monoclonal anti-HSP90 (BD Transduction Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... We used rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs), mouse monoclonal anti-CaM Kinase II α subunit antibody (05-532 ...
-
bioRxiv - Biochemistry 2023Quote: ... custom-made rabbit polyclonal anti-AcK142 or anti-AcK226 (Ez Biolabs) Abs were incubated overnight at 4 °C with the lysate from mock vs ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-SNAP (1:1000, polyclonal, New England Biolabs, Ipswich, MA, P9310S), or mouse anti-tubulin (1:40,000 ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were probed with rabbit polyclonal anti-pansuccinyllysine antibody (PTM Biolabs, PTM-401) at a dilution of 1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Using 10 μg of custom-made rabbit polyclonal anti-AcK142 Ab (Ez Biolabs), AcK142 PNKP was IP’d from 1 mg of GO-treated chromatin fraction from WT-PNKP-FLAG and K142R-PNKP-FLAG expressing cells ...
-
bioRxiv - Genomics 2023Quote: ... +28 μl M.EcoGII at 5 U/μl (NEB M0603S). The DNA was purified using Qiagen PCR columns and quantified by measuring A260 ...
-
bioRxiv - Immunology 2022Quote: ... As an isotype control an unspecific polyclonal rabbit antibody was used (NEB, Frankfurt, Germany). To block ORF8 during differentiation it was preincubated with the polyclonal rabbit anti-ORF8 antibody or isotype over night and added to the monocytes (t=0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Rabbit polyclonal anti-SNAP-tag (Cat no. P9310S, New England Biolabs, 1:1000 dilution). Secondary antibodies used were ...
-
bioRxiv - Genomics 2023Quote: ... (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: SNAP-GCGR was detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/500) followed by goat anti-rabbit IgG H&L HRP (ab6271 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 28 μl 10 x NEB DpnII buffer and 500 units of DpnII (NEB, R0543M) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... 28 novel RNF43 RING domain variants were generated using Q5 mutagenesis (New England Biolabs). All ZNRF3 and RNF43 expression plasmids were full-length sequence verified ...
-
bioRxiv - Neuroscience 2021Quote: ... was separated into low-protein absorption tubes (PROKEEP; Watson Bio Lab, Tokyo, Japan) and reacted with 2 μg of rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs) or normal rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were resolved by SDS-PAGE in urea loading buffer and analysed by Western blot against the SNAP-tag (rabbit polyclonal anti-SNAP-tag antibody P9310S, New England Biolabs) to detect levels of SNAP-GLP-1R in the different fractions ...
-
bioRxiv - Biochemistry 2023Quote: ... Bleo-treated WT-PNKP-FLAG and K226R-PNKP-FLAG cells using 10 μg of custom-made rabbit polyclonal anti-AcK226 Abs (Ez Biolabs). All other subsequent steps and buffers used for IP were the same as described earlier (17,18) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Genomics 2021Quote: A standard 28 base methylated hairpin oligonucleotide (CTGCCAGGATCTTTTTTGATCCTGGCAG) is provided by the manufacturer (New England Biolabs) at 15 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Cell Biology 2022Quote: ... SNAP-GLP-1R and SNAP-GIPR were detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/1,000) followed by goat anti-rabbit HRP secondary (ab6271 ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA (28) using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (sTable 5) ...
-
bioRxiv - Evolutionary Biology 2022Quote: The DMRT regulatory region was amplified from the DMRT>GFP plasmid [28] using Phusion polymerase (New England Biolabs) with primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... were generated from previously described pcDNA3-FLAG-MS2-TTP plasmids (28) using site-directed mutagenesis according to manufacturer’s protocol (New England Biolabs). Expression plasmids for FLAG-tagged constitutive active and catalytically dead MK2 kinases were previously described (12 ...
-
bioRxiv - Biophysics 2020Quote: ... It has been generated by PCR amplification from the pCTCF-GFP vector (28) and sub cloned into the pHalo-GR previously cut with PvuI and XhoI restriction enzymes (New England Biolabs). The pHalo-SMARCA4 was purchased from Promega (pFN21AE0798) ...
-
bioRxiv - Biochemistry 2019Quote: ... The pellet was resuspended in 28 µl hypertonic buffer and incubated at room temperature for 15 min with 1000 gel units of micrococcal nuclease (NEB). Chromatin-bound proteins were released from the DNA by addition of 7 µl of 1 M ammonium sulfate on ice for 5 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... The EC3-5 domains were created by deleting amino acids 28-262 for PCDH15 and 25-228 for CDH23 using site-directed mutagenesis (New England Biolabs). This strategy preserved the native signal peptide sequence ...
-
bioRxiv - Biochemistry 2019Quote: ... In the case of Biotinylated-AviTag-haBiP(28-635)T229A-V461F this protein was also made nucleotide free by the addition of 2 U CIP (NEB) per mg of BiP ...
-
bioRxiv - Cancer Biology 2022Quote: Codon-optimized sequences encoding the DNA-binding domains of human BATF (AA 28-87) and JUNB (AA 269-329) were cloned into pMAL-C2X (NEB). The sequence encoding human IRF4 DBD (AA 19-120 ...
-
bioRxiv - Cell Biology 2023Quote: ... was introduced into an existing pZDonor-AAVS1-CAG-HA-KLF1-ERT2-PolyA plasmid (28) via site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified HDAC insert and the expression vector pET-28 a(+) were digested with BamHI/XhoI restriction enzymes (New England Biolabs, UK), and were ligated over night at 16 °C using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... and was subsequently inserted into a cloning vector pUCNDVH5 (28) by Phusion polymerase chain reaction (Finnzymes Phusion®, New England Biolabs®) (29) ...
-
bioRxiv - Physiology 2022Quote: ... in zebrafish f5 proximal promoter sequences (Fig. 4E, Supplemental Table 5) (28) was conducted using a Q5 site-directed mutagenesis kit (NEB, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... or an appropriate isotype-matched control (polyclonal goat isotype IgG, NEB) was added at a final concentration of 10 μg/ml and incubated overnight ...
-
bioRxiv - Microbiology 2022Quote: ... goat polyclonal anti-UIS4 (LS Biolabs LS-C204260; IFA 1:1000); rabbit polyclonal anti-LISP2 (IFA ...
-
bioRxiv - Genetics 2024Quote: ... Anti-rabbit (#7074, NEB) and anti-mouse (#7076 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rabbit anti-DYKDDDDK (#D6W5B; NEB) and rabbit anti-myc (#71D10 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... rabbit anti-SNAP-tag (NEB; P9310 ...
-
bioRxiv - Microbiology 2019Quote: ... rabbit α-Gaussia Luc (E80235, NEB), rabbit α-PB1 (PA5-34914 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and rabbit anti-myc (#71D10; NEB) primary antibodies were used ...
-
bioRxiv - Plant Biology 2023Quote: ... a CP29A specific rabbit antisera (Kupsch et al., 2012) or anti-SNAP rabbit antisear (NEB, Frankfurt, Germany) in 1:2000 dilution overnight at 4°C and subsequently washed with TBST buffer four times at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... genomic DNA from the polyclonal parasites that returned from transfection was digested with BamHI and SpeI (New England Biolabs) and transferred to membrane (Nytran SuPerCharge ...
-
bioRxiv - Systems Biology 2022Quote: ... anti-SNAP (1:1000, rabbit, NEB, P9310S); anti-MRPS18B ...
-
bioRxiv - Synthetic Biology 2023Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and rabbit anti-NANOG (New England Biolabs). Briefly ...
-
bioRxiv - Genetics 2023Quote: ... and anti-rabbit HRP conjugated (NEB #7074) and anti-mouse HRP conjugated (Cell Signaling Technologies #7076 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SNAP-tag (P9310, New England BioLabs), rabbit anti-beta-tubulin (NB600-936 ...
-
bioRxiv - Cell Biology 2020Quote: ... Pan anti-trimethyllysine (rabbit, PTM Biolabs, PTM-601), SETD2 (rabbit ...