Labshake search
Citations for New England Biolabs :
1 - 50 of 376 citations for Siglec 15 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Neuroscience 2022Quote: The three NMDAR fusion protein constructs were subcloned into pCSE2.7-mIgG2a-Fc-XP (N1-Fc and N2B-Fc) or pCSE2.8-mIgG2a-Fc-Xp (N1-N2B-Fc) using NcoI/NotI (New England Biolabs, Frankfurt, Germany) for mammalian production in Expi293F cells ...
-
bioRxiv - Genomics 2023Quote: ... catalog #FC-131-2001 and #FC-131-2004) using ≈15 ng of first-round PCR product as template and NEBNext Polymerase (New England Biolabs, catalog #M0541S). Final libraries were quantified via Qubit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... To generate a truncated version of Siglec-5 (pME- tSiglec-5) the ITIM and ITSM were excised from the pME-Siglec 5 plasmid with the restriction enzymes BbsI/MfeI (NEB, Ipswich, MA) and blunt ends were generated with DNA Polymerase I ...
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 DNA was extracted and amplified by Q5 High-Fidelity PCR (NEB, M0494S) using primers encompassing the sgRNA recognition site ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15□l of 2.1 buffer (NEB), 30 units of SSP1 (NEB) ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs). Regularly ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Cat. #E7770) or NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (#E7760) ...
-
bioRxiv - Genomics 2022Quote: ... and 15 units of Quick CIP (NEB) by incubating at 37°C for 20 min followed by Quick CIP inactivation at 80°C for 3 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 15 units of Exonuclease V (RecBCD; NEB) and T5 exonuclease (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 15 units of T4 DNA polymerase (NEB) and 5 units of Klenow DNA polymerase (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by a 15 min DNaseI (NEB) digestion at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... followed by 15 min DNAse I (NEB) treatment at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 15 μL T4 ligase (NEB, cat#M0202S), 30 μL T4 ligase buffer and ...
-
bioRxiv - Microbiology 2020Quote: The plasmid pAAV S1-Fc was digested with New England Biolabs (NEB) Restriction Enzymes Pvu I-HF (Cat ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Genomics 2023Quote: ... Ligated junctions were pulled-down with Dynabeads® MyOne™ Streptavidin C1 beads for 15 min at RT and DNA ends were A-tailed with 15 Units of Klenow exo- (cat. M0212L, NEB). Barcoded PerkinElmer adapters (cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Ligated junctions were pulled-down with Dynabeads® MyOne™ Streptavidin C1 beads for 15 min at RT and DNA ends were A-tailed with 15 Units of Klenow exo- (cat. M0212L, NEB). Barcoded PerkinElmer adapters (cat ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 15 units of T4 PNK enzyme (NEB). The reaction was incubated at 37 °C for two hours and PAGE–purified.
-
bioRxiv - Bioengineering 2020Quote: ... and 15 uL of H2O) (New England Biolabs) for 1 hour at 37°C followed by DNase I (10 µL DNase I ...
-
bioRxiv - Genomics 2023Quote: ... 15 μL 2x Q5U Master Mix (NEB M0597S), 0.4 μL 100 μM Nextera P5 index primer and 0.4 μL 100 μM Nextera P7 index primer ...
-
bioRxiv - Genomics 2024Quote: ... and 15 U Klenow exo (New England Biolabs), for 30 min at 37°C before inactivation for 20 min at 65°C ...
-
bioRxiv - Genomics 2024Quote: ... 15 U T4 polynucleotide kinase (New England Biolabs), 5 U Klenow DNA polymerase (Roche) ...
-
bioRxiv - Genomics 2021Quote: ... and 15 units of Phi29 polymerase (New England Biolabs). We used a PCR machine (SimpliAmp ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 U T4 RNA Ligase High Concentration (M0437, NEB)) were added as well as 10 μl 50% PEG8000 and reaction was mixed by pipetting up- and down until beads are resuspended ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 15 units of Klenow (3′→5 ′ exo–) polymerase (NEB) with 66 nM dNTPs for 30 minutes at 30°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 15-20 µL of amylose beads (New England Biolabs) were mixed with (MBP)2-WRC (bait ...
-
bioRxiv - Genomics 2023Quote: ... 15 units of RNase H1 (NEB, cat. no. #M0297) or 1 μg/μL RNase A (Life Technologies ...
-
bioRxiv - Genomics 2023Quote: ... and 15 units of Phi29 polymerase (New England Biolabs). We used a PCR machine (SimpliAmp ...
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Genetics 2019Quote: ... The 3′-UTR sequences of both genes were then amplified from genomic DNA obtained from HEK293 cells with Phusion® High-Fidelity DNA Polymerases (NEB, Ipswich, MA) and cloned into the multiple cloning site of the pMIR-REPORT luciferase miRNA expression vector (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 15 units of Klenow Fragment (3’→5’ exo-, NEB). Following extension reactions ...
-
bioRxiv - Genomics 2021Quote: ... 15 μL of MboI restriction enzyme (New England Biolabs R0147) was used for digesting chromatin from 15 million MEFs ...
-
bioRxiv - Biochemistry 2022Quote: ... Then complexes were bound to 15 µl amylose agarose (NEB) by rotating the tube at 4 °C for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... Desialylation of ACE2-wt-Fc was performed with 2500 U mL-1 neuraminidase (New England Biolabs) in 50 mM sodium citrate (pH 5.0 ...
-
bioRxiv - Microbiology 2019Quote: ... falciparum and human histones (New England Biolabs) (6µg) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 U RNase Inhibitor Human Placenta (NEB), 50 pmol Oligo d(T)23 (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Human CK2 was obtained from NEB (P6010S). IE2-NTD was phosphorylated in buffer provided by the manufacturer which contains 50mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation reactions were conducted using 15 pmol of RtcB (NEB), 1x RtcB buffer (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... 0.025 mM dGTP and 15 U T4 DNA polymerase (NEB # M0203L). The samples were brought up to 50 µL total volume adding ultrapure distilled water ...
-
bioRxiv - Cell Biology 2022Quote: ... and amplified for 15 PCR cycles using Q5 polymerase (NEB, M0491). PCR products were run on a gel ...
-
bioRxiv - Biophysics 2019Quote: ... for 15 minutes at 12°C in 1x buffer 2.1 (NEB), to remove 3’-A overhangs.
-
bioRxiv - Molecular Biology 2023Quote: ... Viral cDNA was amplified for 15 cycles with Phusion polymerase (NEB) using a primer complementary to the adaptor (TGGATTGATATGTAATACGACTCACTATAGG ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µg of pUPRT plasmid was linearised with AgeI-HF (NEB) (GRA59 ...