Labshake search
Citations for New England Biolabs :
1 - 50 of 1669 citations for Siglec 10 Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: The three NMDAR fusion protein constructs were subcloned into pCSE2.7-mIgG2a-Fc-XP (N1-Fc and N2B-Fc) or pCSE2.8-mIgG2a-Fc-Xp (N1-N2B-Fc) using NcoI/NotI (New England Biolabs, Frankfurt, Germany) for mammalian production in Expi293F cells ...
-
bioRxiv - Immunology 2022Quote: ... To generate a truncated version of Siglec-5 (pME- tSiglec-5) the ITIM and ITSM were excised from the pME-Siglec 5 plasmid with the restriction enzymes BbsI/MfeI (NEB, Ipswich, MA) and blunt ends were generated with DNA Polymerase I ...
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 DNA was extracted and amplified by Q5 High-Fidelity PCR (NEB, M0494S) using primers encompassing the sgRNA recognition site ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs). Regularly ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Cat. #E7770) or NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (#E7760) ...
-
bioRxiv - Microbiology 2020Quote: The plasmid pAAV S1-Fc was digested with New England Biolabs (NEB) Restriction Enzymes Pvu I-HF (Cat ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... The 3′-UTR sequences of both genes were then amplified from genomic DNA obtained from HEK293 cells with Phusion® High-Fidelity DNA Polymerases (NEB, Ipswich, MA) and cloned into the multiple cloning site of the pMIR-REPORT luciferase miRNA expression vector (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... Desialylation of ACE2-wt-Fc was performed with 2500 U mL-1 neuraminidase (New England Biolabs) in 50 mM sodium citrate (pH 5.0 ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL 10% NP-40 (NEB), 10 μL PNGase F (NEB ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and AAV9-based rep-cap plasmids incorporating individual heptameric peptides (EC1-10) (pACG2-[EC1-10], pACG2-QuadYF+TV-[EC1-10], and pACG9-[EC1-10]) were generated through site-directed mutagenesis (NEB Q5 site-directed mutagenesis kit ...
-
bioRxiv - Molecular Biology 2021Quote: A CD22 cDNA fragment encoding the first two Ig-like domains fused to an EK-hIgG-Fc fragment was amplified by PCR and cloned into the mammalian expression vector pACP-tag(m)-2 (New England Biolabs).
-
bioRxiv - Immunology 2021Quote: ... IDEZ was used to cleave the Fab (in the supernatant) from the Fc (remained on the magnetic beads) (New England Biolabs) for 1 h at 37°C and collected ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added 150 – 1000 ng of DNA to 1 μl of prepared MBD2-Fc/protein A beads (New England Biolabs), then washed and eluted the DNA as described by Chiou and Bergey (2018) ...
-
bioRxiv - Genomics 2019Quote: ... followed by adding 10 µL PNK (10 U/µL, NEB). The mixture was incubated for 30 min at 37 °C with shaking at 800 rpm ...
-
bioRxiv - Genetics 2024Quote: ... 10 µL 10 mg/mL BSA (NEB cat no. B9000s), 840 μL DNA grade H2O (Invitrogen Waltham ...
-
bioRxiv - Genomics 2021Quote: 10 μg genomic DNA from transfected mESCs were digested using 10 μl 10 U/μL NlaIII (NEB, #R0125S) in a 50 μL final volume for 3 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... in 50 μl of total reaction volume (10 μl 5X KAPA buffer, 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 50 μl of total reaction volume (10 μl 5X KAPA buffer, 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 50 μl of total reaction volume (10 μl 5X KAPA buffer, 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM MgCl2) and 10 U Klenow (exo-) polymerase (NEB, M0212S) and α-32P-dCTP (Perkin Elmer ...
-
bioRxiv - Genomics 2023Quote: ... catalog #FC-131-2001 and #FC-131-2004) using ≈15 ng of first-round PCR product as template and NEBNext Polymerase (New England Biolabs, catalog #M0541S). Final libraries were quantified via Qubit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA/sgRNA/Cas9 ratios of 1/10/10 were used in a 10 µl reaction using the buffer supplied (NEB) and DEPC-treated water (Haussmann et al ...
-
bioRxiv - Genomics 2019Quote: ... DNA was digested by adding 10 µL NlaIII (10 U/µL, NEB) and incubated for 3½ h at 37 °C with shaking at 1200 rpm ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ligation reaction (10 μL) consisted of 10 units of BbsI (NEB), 600 units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse α-MBP (NEB, 1:10000); mouse α-Pol II CTD clone 8WG16 (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...