Labshake search
Citations for New England Biolabs :
1 - 50 of 1262 citations for Septin 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Desalted peptides were dissolved at a concentration of 3 µg/µL in 1x CutSmart buffer (NEB, 50 mM potassium acetate ...
-
bioRxiv - Genomics 2023Quote: Each 900 ng of high molecular weight NA12878 DNA was preprocessed by first blocking at the 3’ ends with Klenow (exo-) (NEB) in the presence of 10 µM dideoxynucleotides and 1X NEBuffer 3.1 for 30m at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lyophilized peptides were resuspended in 200 µl of 50 mM ammonium bicarbonate to which 3 µl of PNGaseF (New England Biolabs) were added for a 4h incubation at 37C ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Three peptide phage libraries from NEB “New England Biolabs” ...
-
bioRxiv - Genomics 2023Quote: ... Blocking was achieved using 1% BSA (NEB) and 0.1% Tween-20 in 1× PBS for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Peptide-N-Glycosidase F (PNGase F; NEB, P0704) treatment of lysates was performed as described in the manufacturer’s directions ...
-
bioRxiv - Genetics 2022Quote: ... and blocking oligo wash (0.25X T4 RNA ligase buffer (NEB), 0.3uM blocking oligo ...
-
bioRxiv - Cancer Biology 2022Quote: ... and blocking oligo wash (0.25X T4 RNA ligase buffer (NEB), 0.3 µM blocking oligo ...
-
bioRxiv - Molecular Biology 2021Quote: ... and blocking oligo wash (0.25X T4 RNA ligase buffer (NEB), 0.3uM blocking oligo ...
-
bioRxiv - Microbiology 2021Quote: ... Peptide-N-glycosidase F (PNGase F) (New England BioLabs) was used to remove all N-linked oligosaccharides for 1 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... or for peptide N-glycosidase F (PNGase-F, NEB) digestion using 500 units PNGase-F for 1,5h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... and tryptic peptides were generated using Trypsin-Ultra (P8101S, NEB) following the protocol described previously2 ...
-
bioRxiv - Neuroscience 2022Quote: ... or peptide N-glycanase (PNGase, New England Biolabs, 1,000 units) for 6 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of peptide N-glycosidase F (New England Biolabs) were added ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Genomics 2022Quote: ... 500 nL of 5hmC-blocking mix (1 U T4-BGT (NEB, M0357L), 6x UDP-glucose ...
-
bioRxiv - Immunology 2020Quote: ... The peptides were first digested with Endo H (New England Biolabs) to deplete oligomannose- and hybrid-type glycans and leave a single GlcNAc residue at the corresponding site ...
-
bioRxiv - Bioengineering 2020Quote: ... reesei strain by peptide N-glycosidase F (PNGase F, NEB, P0704) (Wang et al ...
-
bioRxiv - Cell Biology 2022Quote: ... or Peptide-N-Glycosidase F (PNGase F) (New England Biolabs, #P0704S) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... and Ph.D.-C7 peptide library (New England Biolabs, Ipswich, MA, USA) for the identification of AbOmpA binding phage ...
-
bioRxiv - Biochemistry 2021Quote: Peptide-N-glycosidase F (PNGase F) (New England Biolabs Inc., Cat. P0704S) was used for complete removal of N-linked oligosaccharides ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of biotinylated histone peptides were incubated with streptavidin beads (NEB) in binding buffer (50 mM Tris-HCl 8.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... separated via self-cleaving T2A peptide was generated via Gibson Assembly (NEB). This cassette including a 5’ chimeric intron and 3’ poly adenylation signal sequence replaces the sequence of Pax7 exon 1 immediately 3’ of the ATG start codon ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Immunology 2022Quote: ... N-glycans were enzymatically removed from the underlying peptides with PNGase F (NEB) overnight at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... A 7-mer random peptide library (E8100S, Ph.D. -7, New England Biolabs, USA) was panned overnight at 4°C on pooled human IgM adsorbed on polystyrene plates at a concentration of 0.1 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The Peptide-N-Glycosidase F (PNGase F) enzyme (New England Biolabs, catalog #: P0704L)-treated samples served as a control for unglycosylated α1 subunits ...
-
bioRxiv - Immunology 2023Quote: ... N-glycans were enzymatically removed from the tryptic peptides with PNGase F (NEB) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bead slurry was directly treated with 3 µL Klenow (3’→5’ exo-) (NEB) in 50 µL NEB Buffer #2 with 0.2 mM ATP at 37 °C for 30 min to add 3’ overhangs to DNA ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 µl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3□μf USER Enzyme (NEB) was then used with the size-selected ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...