Labshake search
Citations for New England Biolabs :
1 - 50 of 95 citations for SUMO2 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... was PCR amplified from pDONR221-SUMO2 plasmid (purchased from DNASU plasmid repository, United States) using Phusion® High-Fidelity DNA Polymerase (NEB, USA) with forward primer 5’ GATGGATCCATGGCCGACGAAAAG 3’ and reverse primer 5’ TTCAAGCTTTTAACCTCCCGTCTGCTG 3’ as per the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Three peptide phage libraries from NEB “New England Biolabs” ...
-
bioRxiv - Genomics 2023Quote: ... Blocking was achieved using 1% BSA (NEB) and 0.1% Tween-20 in 1× PBS for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Peptide-N-Glycosidase F (PNGase F; NEB, P0704) treatment of lysates was performed as described in the manufacturer’s directions ...
-
bioRxiv - Genetics 2022Quote: ... and blocking oligo wash (0.25X T4 RNA ligase buffer (NEB), 0.3uM blocking oligo ...
-
bioRxiv - Cancer Biology 2022Quote: ... and blocking oligo wash (0.25X T4 RNA ligase buffer (NEB), 0.3 µM blocking oligo ...
-
bioRxiv - Molecular Biology 2021Quote: ... and blocking oligo wash (0.25X T4 RNA ligase buffer (NEB), 0.3uM blocking oligo ...
-
bioRxiv - Microbiology 2021Quote: ... Peptide-N-glycosidase F (PNGase F) (New England BioLabs) was used to remove all N-linked oligosaccharides for 1 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... or for peptide N-glycosidase F (PNGase-F, NEB) digestion using 500 units PNGase-F for 1,5h at 37°C ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... and tryptic peptides were generated using Trypsin-Ultra (P8101S, NEB) following the protocol described previously2 ...
-
bioRxiv - Neuroscience 2022Quote: ... or peptide N-glycanase (PNGase, New England Biolabs, 1,000 units) for 6 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of peptide N-glycosidase F (New England Biolabs) were added ...
-
bioRxiv - Genomics 2022Quote: ... 500 nL of 5hmC-blocking mix (1 U T4-BGT (NEB, M0357L), 6x UDP-glucose ...
-
bioRxiv - Immunology 2020Quote: ... The peptides were first digested with Endo H (New England Biolabs) to deplete oligomannose- and hybrid-type glycans and leave a single GlcNAc residue at the corresponding site ...
-
bioRxiv - Bioengineering 2020Quote: ... reesei strain by peptide N-glycosidase F (PNGase F, NEB, P0704) (Wang et al ...
-
bioRxiv - Cell Biology 2022Quote: ... or Peptide-N-Glycosidase F (PNGase F) (New England Biolabs, #P0704S) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... and Ph.D.-C7 peptide library (New England Biolabs, Ipswich, MA, USA) for the identification of AbOmpA binding phage ...
-
bioRxiv - Biochemistry 2021Quote: Peptide-N-glycosidase F (PNGase F) (New England Biolabs Inc., Cat. P0704S) was used for complete removal of N-linked oligosaccharides ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of biotinylated histone peptides were incubated with streptavidin beads (NEB) in binding buffer (50 mM Tris-HCl 8.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... separated via self-cleaving T2A peptide was generated via Gibson Assembly (NEB). This cassette including a 5’ chimeric intron and 3’ poly adenylation signal sequence replaces the sequence of Pax7 exon 1 immediately 3’ of the ATG start codon ...
-
bioRxiv - Immunology 2022Quote: ... N-glycans were enzymatically removed from the underlying peptides with PNGase F (NEB) overnight at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... A 7-mer random peptide library (E8100S, Ph.D. -7, New England Biolabs, USA) was panned overnight at 4°C on pooled human IgM adsorbed on polystyrene plates at a concentration of 0.1 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The Peptide-N-Glycosidase F (PNGase F) enzyme (New England Biolabs, catalog #: P0704L)-treated samples served as a control for unglycosylated α1 subunits ...
-
bioRxiv - Immunology 2023Quote: ... N-glycans were enzymatically removed from the tryptic peptides with PNGase F (NEB) overnight at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: Phage display experiments were performed using the PhD-12 peptide phage display kit (NEB). All steps involving the pipetting of phage-containing samples was done using filter tips (Rainin) ...
-
bioRxiv - Biochemistry 2020Quote: ... tsetse saliva was treated with peptide-N-glycosidase A (PNGase A, New England Biolabs), which releases all N-linked glycans ...
-
bioRxiv - Cell Biology 2019Quote: ... The PfGRP170 transit peptide PCR was digested with Nhe1 and AatII (New England Biolabs) and the GFP PCR was digested with AatII and BglII (New England Biolabs) ...
-
bioRxiv - Neuroscience 2021Quote: ... Deglycosylation was performed with peptide-N-glycosidase F (PNGase F; New England Biolabs, USA) following the manufacturer’s instructions [28] ...
-
bioRxiv - Neuroscience 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabsⓇ Inc., MA, USA) was preferred in order to select aggregation inhibitory peptide selection ...
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was preferred ...
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was used ...
-
bioRxiv - Biochemistry 2020Quote: Tsetse salivary proteins were treated with peptide-N-glycosidase F (PNGase F, New England Biolabs), which cleaves all N-linked glycans except those with an α-1,3 fucose modification of the chitobiose core [20] ...
-
bioRxiv - Neuroscience 2019Quote: ... protein samples were treated with peptide-N-Glycosidase F (PNGase) (New England Biolabs, Whitby, ON) following manufacturers guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs® Inc., MA, USA) was amplified as following the recommended protocols by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... to prevent exoIII digestion on the arrest peptide side and then with AvrII (NEB, R0174S) to allow for exoIII digestion towards the candidate protein ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... g165 and g166 without the predicted signal peptides were PCR-amplified with Phusion polymerase (NEB) from genomic DNA of P ...
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...
-
bioRxiv - Genomics 2021Quote: ... Cells were centrifuged and resuspended in 600 μl Blocking buffer (PBS + 2 % BSA (B9000S, New England Biolabs)) and incubated for 5 min on ice ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Synthetic Biology 2021Quote: ... DNA templates for MS-QBiC peptide synthesis were amplified by PCR using Taq DNA polymerase (NEB) with a T7 promoter primer (5′-GGGCCTAATACGACTCACTATAG-3′ ...
-
bioRxiv - Biochemistry 2020Quote: ... Desalted peptides were dissolved at a concentration of 3 µg/µL in 1x CutSmart buffer (NEB, 50 mM potassium acetate ...
-
bioRxiv - Cell Biology 2022Quote: ... enzyme digestion or Peptide-N-Glycosidase F (PNGase F) (New England Biolabs, Ipswich, MA, catalog #: P0704L) enzyme digestion was performed according to manufacturer’s instruction and the published procedure [49].
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: Lysine-succinylated peptides were enriched using agarose-conjugated pan anti-succinyllysine antibody (PTM Biolabs, Hangzhou, China). In brief ...
-
bioRxiv - Genetics 2023Quote: ... following which they were incubated in blocking buffer composed of 0.5 mg/ml BSA (New England Biolabs, #B9001S), 80 units of RNAse-OUT RNAse inhibitor (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... pUHES:UmPit2+SP:mCherry with its natural signal peptide was generated via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) by combining PCR-amplified UmPit2+SP:mCherry using primers 2127 + 2128 and PCR-amplified pUHESdest using primers 2125 + 2126 without UhAvr1 signal peptide ...
-
bioRxiv - Cell Biology 2020Quote: ... These peptides were used as the substrate in a PKA kinase assay kit (New England Biolabs, #P6000S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... These peptides were used as the substrate in a PKA kinase assay kit (New England Biolabs, #P6000S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... then deglycosylated with 2000 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA). All samples were incubated for 16 hours at 37°C ...