Labshake search
Citations for New England Biolabs :
1 - 50 of 212 citations for S R S AHPC C8 NH2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Endo S (NEB), or Endo F1 (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... and S-adenosylmethionine (NEB). RNA was chromatographically purified using Capto Core 700 resin (GE Healthcare ...
-
bioRxiv - Developmental Biology 2019Quote: ... 160μM S-adenosylmethionine (NEB), 1Uμl-1 RNasein (Promega) ...
-
bioRxiv - Biochemistry 2023Quote: ... SAM (S-adenosylmethionine) (NEB) at 0.6 mM and sucrose at 300 mM ...
-
bioRxiv - Biochemistry 2020Quote: ... 1800 s and 3600 s the reaction was stopped by adding lambda DNA (NEB) to a final concentration of 0.2 mg/mL ...
-
bioRxiv - Genomics 2021Quote: ... 160 μM S-adenosylmethionine (NEB), 1 U μl−1 RNasein (Promega) ...
-
bioRxiv - Genomics 2021Quote: ... 96 μM S-adenosylmethionine (NEB) and 200 U of M.CviPI (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... per manufacturer ’s instructions (NEB). Library quality was assessed by Fragment Analyzer NGS (Agilent) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were labelled with BG-S-S-649 (1 μM, a gift from New England Biolabs). After washing ...
-
bioRxiv - Neuroscience 2022Quote: ... and β-GlcNAcase S (P0744, NEB). In reactions containing α-mannosidase and for all experiments shown in Fig ...
-
bioRxiv - Immunology 2023Quote: ... and S-adenosylmethionine (New England Biolabs).
-
bioRxiv - Genomics 2023Quote: S-Adenosylmethionine 32 mM (NEB B9003S)
-
bioRxiv - Biochemistry 2024Quote: ... 150 μM S-adenosyl-methionine (NEB)) ...
-
bioRxiv - Molecular Biology 2021Quote: Myc-Tag (9B11) antibody (NEB 2276 S) and mouse IgG (Santa Cruz sc-2025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Genomics 2021Quote: ... 0.2 mM S-adenosylmethionine (SAM) (NEB, #B9003) in 60 μL total volume for 30 min at 37 ºC ...
-
bioRxiv - Genetics 2021Quote: ... 80 μM S-adenosylmethionine (New England Biolabs), and 40 units of EcoRI methyltransferase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 160 μM S-adenosylmethionine (NEB, Cat# B9003S), 1 U/μl RNasin (Promega ...
-
bioRxiv - Bioengineering 2022Quote: ... 200 nM Cas9 (S. pyogenes, NEB, M0368), 120 nM fluorescent beacon ...
-
bioRxiv - Microbiology 2023Quote: ... containing 160 μM S-adenosylmethionine (SAM: NEB). This five-enzyme methylation cocktail was previously necessary to achieve genetic alteration in the strain as described in Umaña et al14.
-
bioRxiv - Genomics 2023Quote: ... and SalI-HF enzyme (NEB; r3138 S) digested hPGK-STARR-seq vector ...
-
bioRxiv - Cell Biology 2020Quote: ... Additional S/A and S/D mutations were generated by using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were labelled with the cleavable SNAP-tag probe BG-S-S-549 (a gift from New England Biolabs) in complete medium for 30 min at room temperature ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 s annealing at 63 °C and 30 s elongation by Q5 High-Fidelity DNA Polymerase (New England Biolabs) at 72 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S R403T and RaTG13 S T403R/T403A mutant plasmids were generated using Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Cell Biology 2021Quote: MBP-M18BP1.S-161-580 and MBP-M18BP1.S-161-580 SANTA were independently expressed from modified pMal-c2x plasmids (NEB) in BL21 (DE3 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were labelled with the cleavable SNAP-tag probe BG-S-S-649 (featuring the DY-649 fluorophore, a gift from New England Biolabs) in complete medium for 30 minutes at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... coli BL21 (DE3)-pLyse S (NEB, Catalogue # C3010I) cells ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.1 mM S-adenosylmethionine (SAM, New England Biolabs), 2 u/µl NxGen RNase inhibitor (Lucigen) ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5 mM S-adenosylmethionine (SAM, NEB, Ipswich, MA), 0.5 U/μl RNasin (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1 mM S-adenosylmethionine (SAM, New England Biolabs), 1 u/µl Murine RNase inhibitor (Vazyme) ...
-
bioRxiv - Plant Biology 2022Quote: ... oligo(dT)s and Murine RNAse inhibitor (NEB) in a 20 μL reaction volume according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.5 µg/µl BSA (NEB, B9000 S). Immunoprecipitations were performed at 4°C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... 20 s annealing at the temperature given by NEB TM calculator (https://tmcalculator.neb.com) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 640 µM S-adenosylmethionine (SAM) (New England Biolabs). The reaction was incubated for 5 min at 37 °C and placed on ice until grids were prepared.
-
bioRxiv - Genomics 2019Quote: ... 96 μM S-adenosylmethionine (SAM; New England Biolabs, NEB), and 200 U M ...
-
bioRxiv - Genomics 2019Quote: ... 96 μM S-adenosylmethionine (SAM; New England Biolabs, NEB), and 200 U M ...
-
bioRxiv - Biochemistry 2021Quote: ... two guide RNAs and the Cas9 enzyme (S. pyogenes, NEB) were diluted to a final concentration of 20 ng/µl each in injection buffer ...
-
bioRxiv - Microbiology 2020Quote: ... 45 s using the NEBNext Magnesium RNA Fragmentation Module (NEB) followed by RNA purification with the Zymo RNA Clean & Concentrator kit ...
-
bioRxiv - Plant Biology 2022Quote: ... enzyme (MBP-DcATX1C) and S-adenosyl-L-methionine (SAM; NEB) were incubated for 0h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 μl of 32 mM S-adenosylmethionine (SAM; NEB, B9003) and 50 μl of M.CviPI (NEB ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Cell Biology 2020Quote: ... or the LunaScript RT Super Mix Kit (NEB # E3010(S/L), Ipswich ...
-
bioRxiv - Molecular Biology 2020Quote: ... S protein were first incubated with either 1000U/mL PNGase F (NEB) or deactivated PNGase F at 37 °C for 14 h ...
-
bioRxiv - Biochemistry 2020Quote: ... 30 nM dCas9 protein (dCas9 Nuclease, S. pyogenes, M0652, New England Biolabs), 1–4× 104 Beads@oligo ...
-
bioRxiv - Biophysics 2020Quote: ... Deglycosylated trastuzumab was obtained by treatment with Endo S (New England BioLabs) at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 mM Spermidine) supplemented with 0.8 mM S-adenosyl-methionine (NEB B9003S). A negative control was prepared without MTase ...
-
bioRxiv - Biochemistry 2020Quote: Three microgram of full-length S protein were treated with PNGase F (NEB) for N-glycan release according to the manufacture’s instruction ...