Labshake search
Citations for New England Biolabs :
1 - 50 of 3191 citations for Ribose Phosphate Pyrophosphokinase 1 PRPS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... poly (ADP-ribose) polymerase (PARP) (both from Cell Signaling via New England Biolabs, Frankfurt, Germany), MYCN (abcam ...
-
bioRxiv - Genomics 2023Quote: ... we improved the ribose-seq protocol by i) introducing NEBNext® dsDNA Fragmentase® (New England Biolabs) to fully fragment the human genomic DNA samples ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAse I digestion to analyse 2’-O-ribose methylation was done in the presence of 10 U T4 PNK (NEB) in 50 mM Tris-acetate (pH 6.5) ...
-
bioRxiv - Microbiology 2021Quote: ... After incubation with 5‘-phosphate-dependent exoribonuclease XRN-1 (New England BioLabs, Inc., USA), samples were treated with RNA 5‘ polyphosphatase (Lucigen) ...
-
bioRxiv - Microbiology 2020Quote: ... 30 mM acetyl phosphate or 1 µl Calf Intestinal Alkaline Phosphatase (CIP) (NEB, catalog#: M0290V) was added to the solution ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: ... 1 unit of λ-phosphatase is defined as the amount of enzyme that hydrolyzes 1 nmol of p-nitrophenyl phosphate in 1 minute at 30°C (New England Biolabs). After 45 minutes of incubation ...
-
bioRxiv - Cell Biology 2021Quote: 500mM p-Nitrophenyl Phosphate (pNPP, NEB, P0757S) substrate solution was diluted to 20 mM in phosphatase reaction buffer (PRB ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-phosphate was added via T4 polynucleotide kinase (NEB) at 37 ºC for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... we used a colorimetric assay using p-Nitrophenyl phosphate (pNPP) (NEB) as a substrate ...
-
bioRxiv - Cancer Biology 2024Quote: ... and treated with 800 U of Lambda Phosphates (New England Biolabs) for 30 min at 30°C ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Microbiology 2020Quote: ... samples were washed in phosphate buffered saline (PBS) and labelled with 1:500 of 10mg/mL Hoechst 33342 (New England Biolabs, Cat# 4082S) for 10 min with a subsequent wash in PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed cells were resuspended in 1 mL spheroplast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB S1402S], 20 µM beta-mercaptoethanol), and 1.2–5 µL 100T zymolyase (US Biological Z1005 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2.5mM Na2P2H2O7 and 20mM β-glycerol phosphate) and 10mM ATP (New England Biolabs) to a total volume of 50µl ...
-
bioRxiv - Plant Biology 2022Quote: ... and 6 µM p-Nitrophenyl Phosphate (pNPP) (New England Biolabs Catalog Number P0757S) at 25°C at a pH of 5.0 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Neuroscience 2022Quote: ... and probed with p62 antibody (NEB D5L7G, 1:800) and streptavidin-594 (Biolegend 405240 ...
-
bioRxiv - Molecular Biology 2019Quote: Purified RNAs were treated with alkaline phosphatase (Calf Intestinal Phosphate from New England Biolabs) at 50°C for 15min followed by heat inactivation at 95°C for 2.5min ...
-
bioRxiv - Cell Biology 2019Quote: ... immunoprecipitated beads were incubated with 40 Units of lambda protein phosphate (New England Biolabs) in a 50 μl reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoprecipitated beads were incubated with 40 Units of lambda protein phosphate (New England Biolabs) in a 50 μl reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl anti-MBP Monoclonal Antibody (New England Biolabs, #E8032L) and 6 μl anti-E ...
-
bioRxiv - Microbiology 2019Quote: ... then 100 μL of 4 mg/mL p-nitrophenyl phosphate (New England Biolabs, MA, USA) was added and the mixture was vortexed again ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 4 (supplied by NEB, 500 mM Sodium Phosphate, pH 4.5), and 1 μL of α1-2,3,6 Mannosidase.
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 2 (supplied by NEB, 500 mM Sodium Phosphate, pH 7.5), and 1 μL of PNGase ...
-
bioRxiv - Biochemistry 2020Quote: ... The 5’ phosphate of transcribed RNA ligands was removed using calf intestinal phosphatase (CIP, NEB) and then replaced with 32P using T4 polynucleotide kinase (PNK ...
-
bioRxiv - Genetics 2019Quote: ... and phosphate groups added to the 5’ends using T4 Polynucleotide Kinase (New England Biolabs, M0201S) by first incubating for 30 minutes without ATP and then 30 min with ATP to remove and add the phosphate group ...
-
bioRxiv - Microbiology 2020Quote: ... either 30 mM acetyl phosphate or 0.5 μl Calf Intestinal Alkaline Phosphatase (CIP) (NEB, catalog#: M0290V) was added to the solution ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Dephosphorylation of cyclic phosphate groups were carried out with T4 PNK (10 U/uL, M0201, NEB) in a low pH buffer (5X PNK pH 6.5 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Dephosphorylation of cyclic phosphate groups was carried out with T4 PNK (10 U/µL, M0201, NEB) in a low pH buffer (25 mM MES (2-(N-morpholino)ethanesulfonic acid) ...
-
bioRxiv - Microbiology 2021Quote: ... or murine anti-MBP monoclonal antibody (1:10,000; NEB; catalog# E8032S) in the above LI-COR blocking buffer ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: GBL phosphate (8) was incubated with 5 units of calf intestinal alkaline phosphatase (CIP, New England Biolabs) in 50 mM HEPES buffer (pH 8.0 ...
-
bioRxiv - Plant Biology 2021Quote: ... The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB) and [γ-32P]ATP ...
-
bioRxiv - Microbiology 2020Quote: ... suspended in 200 µL of phosphate saline buffer (PBS) and labeled with TMR-Star (New England Biolabs) for 30 min at 37°C in the dark at a final concentration of 250 nM ...
-
bioRxiv - Cancer Biology 2021Quote: ... The membrane was incubated with HRP-conjugated secondary antibodies (1:5000, NEB) for 45 mins at RT ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... γ-phosphate was then removed from excess [γ-32P]ATP with 0.5 U apyrase (New England Biolabs M0398) in 1X apyrase buffer for 10 min at 30°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK, NEB). Next ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Molecular Biology 2020Quote: ... coli Poly(A) polymerase and 5’-ends were converted to mono-phosphates by incubation with RNA 5’ Pyrophosphohydrolase (NEB). Subsequently ...
-
bioRxiv - Genomics 2023Quote: ... A mono-phosphate group was then added back to the 5’-end of RNAs by polynucleotide kinase (PNK, NEB) in the presence of 10mM ATP ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: Specific antibodies against Slug (C19G7, Cell Signaling Technology, NEB, Frankfurt, Germany, #9585, 1:400), pan-cytokeratine (polyclonal ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were then incubated for 1 hour with anti-MBP antibody (New England BioLabs) solution diluted in calcium containing blocking buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphate TCAGA GTCGA GATCG GAAGA GCGTC GTGGA TCCAG ACGTG TGCTC TTCCG ATCT) with 2x Blunt/TA ligase master mix (NEB) at 25 °C for 1h ...
-
bioRxiv - Plant Biology 2021Quote: ... the RNA was subsequently ligated to an RNA adapter with a 3’ phosphate group by RtcB ligase (#M0458S, New England Biolabs). The ligated RNA was converted to cDNA with RevertAid first strand cDNA synthesis kit (#K1612 ...