Labshake search
Citations for New England Biolabs :
1 - 50 of 8841 citations for Resistant Starch Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids from antibiotic-resistant clones were purified using a Monarch plasmid miniprep kit (New England Biolabs, USA) and subjected to whole plasmid sequencing (SNPsaurus ...
-
bioRxiv - Molecular Biology 2019Quote: Electro-competent DH10B T1 phage resistant (New England BioLabs) harboring RP11-737E8 BAC cells were prepared as described previously.14 2 μl (25ng/μl ...
-
bioRxiv - Biophysics 2022Quote: ... Toxicity-resistant strains such as NEB 5-alpha F’Iq (NEB) and ABLE K (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 strain resistant to phage T1 (New England Biolabs) harboring the pRARE2 plasmid and plated onto LB+Agar plates supplemented with kanamycin (Kan ...
-
bioRxiv - Biochemistry 2019Quote: peYFP-C1-PALB2 was modified to be resistant to PALB2 siRNA by Q5 Site-Directed Mutagenesis Kit (NEB, E0554) using primers JYM3892/3893 (Table S4) ...
-
bioRxiv - Neuroscience 2021Quote: ... The coding sequence of GluN2A and GluN2B point mutations for sgRNA resistant plasmid (GluN2A: AGCCACGACGTGACAGAACGCGAACTT to AGTCACGACGTGACTGAGAGAGAACTT; GluN2B: ATGTCTGACCGGAAGATCCAGGGG to ATGTCTGATCGTAAGATTCAAGGA) were generated by Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Genetics 2020Quote: ... and wobble mutations to make constructs resistant to shOTUD5#5 were introduced in this vector using the Q5 site-directed mutagenesis kit (E0554, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The miR823-resistant CMT3 construct (rCMT3) was generated by PCR site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs) using the cCMT3 construct as a template to introduce six silent mutations as shown in Fig ...
-
bioRxiv - Immunology 2022Quote: ... Short hairpin resistant chimeric mutants of Flag-tagged GLUT3 alleles were generated using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, E5520) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from starter cultures of the three original ancestor isolates and 10 trimethoprim-resistant derivatives using New England Biolabs Monarch Genomic DNA Extraction Kit (New England Biolabs, USA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... The culture supernatant was projected to perform luciferase assay with Gaussia Luciferase assay kit and Cypridina Luciferase assay kit (NEB) following their description.
-
bioRxiv - Developmental Biology 2019Quote: ... The miR167-resistant ARF8 construct (rARF8) was generated by PCR site-directed mutagenesis (NEB) of the gARF8 entry clone ...
-
bioRxiv - Cell Biology 2023Quote: ... The Oxiselect Comet Assay Kit (Cell-Biolabs) was used as a reference for the experiment ...
-
bioRxiv - Microbiology 2020Quote: ... the BioLux® Gaussia Luciferase Assay Kit (NEB, discontinued) or the GAR-2B Gaussia Luciferase Assay (Targeting Systems ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Cypridina Luciferase Assay Kit (New England Biolabs) and Gaussia luciferase was assayed from 1:40 diluted cell culture supernatant using either the Stop & Glo reagent from the DualLuciferase® Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Gaussia Luciferase Assay Kit (New England Biolabs) in a Lumat LB 9507 luminometer (Berthold Technologies).
-
bioRxiv - Microbiology 2021Quote: ... or a Biolux Gaussia luciferase assay kit (New England BioLabs) and a GloMax microplate reader (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA resistant synonymous mutations were introduced to ORC2 by PCR mutagenesis using Phusion high fidelity DNA polymerase (NEB). Guide RNA resistant ORC2 (ORC2gr ...
-
bioRxiv - Genetics 2020Quote: ... Each of them was made by assembling a synthetic gBlock DNA fragment with a PCR-amplified Kanamycin resistant backbone using NEBuilder DNA Assembly (New England Biolabs). The region to be PCR-amplified in each vector contains a gRNA scaffold followed by either a tRNA or the U6:3 promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... The open reading frame for a KIF18A wild-type siRNA resistant construct51 and pEM791 vector49 were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... The murJ locus in the gDNA of the SglPP7-resistant mutants was amplified by PCR using Phusion high-fidelity DNA polymerase (New England Biolabs) with the primers KC230 and KC234 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Sequence-verified sub-part plasmids are then used as inputs for assembly into carbenicillin-resistant entry vectors using BsaI-v2 HF (NEB) to yield genetic part plasmids (i.e. ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA resistant fragments, and pEM791 vector (Sturgill et al., 2016) were amplified with primers designed for Gibson Assembly (New England BioLabs) and subsequently assembled via Gibson Assembly ...
-
bioRxiv - Biochemistry 2023Quote: ... or targeting a specific sequence within the puromycin resistant cassette (P3 Supplementary Table 2) were mixed with 1 unit HiFi Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer with MgCl2 ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR sgRNA resistant synonymous or functional domain point mutations were introduced by PCR mutagenesis using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2631). Stable cell lines were generated using the pLU vectors and selected with puromycin or blasticidin ...
-
bioRxiv - Microbiology 2019Quote: ... Assays were performed using NEB BioLux Gaussia Luciferase (GLuc) kit (NEB #E3300L) following the stabilized protocol ...
-
bioRxiv - Microbiology 2024Quote: In vitro transcription/translation assays were conducted using the PURExpress kit (NEB) according to the manufacturer’s protocol with a 2-hour incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: Coupled transcription-translation assays were carried out with the PURExpress kit (New England BioLabs) as described in (Lukasiewicz and Contreras ...
-
bioRxiv - Biochemistry 2023Quote: ... Assays were set-up using PURExpress in vitro protein synthesis kit (New England Biolabs) with a cloned full-length DHFR template ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was purified by silica-based SPE using Monarch RNA Cleanup Kits (for in vitro assays) or Total RNA Miniprep Kit for intracellular samples (NEB).
-
bioRxiv - Immunology 2021Quote: We quantified plasma luciferase activity by a BioLux Gaussia Luciferase Assay Kit (NEB, Ipswich, MA) from 10 μL plasma acquired by retro-orbital bleeding ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the High Sensitivity DNA Assay and NEBNext Library Quant Kit for Illumina (NEB, E7630). Finally ...
-
bioRxiv - Synthetic Biology 2020Quote: ... GLuc activity in samples was measured using the Biolux Gaussia Luciferase Assay kit (NEB, Ipswich, MA). GLuc assay solution (50 μL ...
-
bioRxiv - Neuroscience 2019Quote: ... and 24 hours of incubation GLuc activity was quantified using the BioLux Gaussia Luciferase Assay Kit (NEB) according to the manufacturer’s instructions with luminescent detection on a SpectraMax M5 Microplate Reader (Molecular Devices ...
-
bioRxiv - Cell Biology 2020Quote: ... These peptides were used as the substrate in a PKA kinase assay kit (New England Biolabs, #P6000S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... These peptides were used as the substrate in a PKA kinase assay kit (New England Biolabs, #P6000S) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... The assay was performed using the PURExpress In Vitro Protein Synthesis Kit (E6800S New England Biolabs, Inc.), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB) with the CDC-derived primers for N1 and N2 gene targets and the reaction was performed using the QuantStudio™ 5 System (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Microbiology 2022Quote: ... while Gluc and Cluc expression levels were determined using Biolux Gaussia or Cypridina luciferase assay kits (New England BioLabs) and a microplate reader ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 pmol of TP_MAAAPQKCAAA* mRNA (see “Toeprinting assays” section) and components of the PURExpress ΔRibosomes Kit (New England Biolabs). The reaction was incubated at 37ºC for 20 min and then diluted in 50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The chambers of the microplate were pre-treated with 1 mg/ml BSA (NEB) for 30 min before aspirating the BSA ...
-
bioRxiv - Biophysics 2021Quote: ... Indel frequencies at the SaCas9 target site were assessed via a T7E1 assay with the EnGen Mutation Detection Kit (NEB), using the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Final Illumina libraries were assessed for quality using an Agilent Bioanalyzer DNA High Sensitivity Assay and qPCR quantification was performed using NEBNext Library Quant kit for Illumina (New England Biolabs). Individual libraries were pooled equimolarly ...
-
bioRxiv - Genetics 2019Quote: ... in accordance with the manufacturer’s recommendations and were validated using the Agilent High Sensitivity DNA assay on the Agilent Bioanalyzer 2100 system and quantified by NEBNext Library Quant Kit for Illumina (New England Biolabs). After clustering of the index-coded samples ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Concentrations were measured by Qubit RNA HS assay kit and 750 ng of Dnase-treated RNA was used for rRNA depletion by NEB Next rRNA depletion kit (Human/Mouse/Rat) ...
-
bioRxiv - Plant Biology 2021Quote: ... All other mutations of the constructs used for in vitro and in vivo assays were introduced using a Q5 site-directed mutagenesis kit (NEB). All constructs were verified by DNA sequencing.
-
bioRxiv - Biochemistry 2023Quote: A luminescence based translation inhibition assay was performed using an in-vitro translation PURExpress® Δ Ribosome Kit from (NEB) The constituents of the kit were incubated with 25 ng pMSR DNA template ...