Labshake search
Citations for New England Biolabs :
1 - 50 of 1455 citations for Recombinant Mouse Erbb2 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: Recombinant proteins were labeled with SNAP-Surface 549 dye (New England BioLabs, Cat# S9112S) for visualization ...
-
bioRxiv - Plant Biology 2023Quote: ... and recombinant MBP-tagged proteins purification were performed according to the manufacturer’s instructions of Amylose Resin (NEB).
-
bioRxiv - Cell Biology 2022Quote: Recombinant C-terminally FLAG-Tagged TEX264 was produced by PURExpress in vitro protein synthesis kit (E6800; New England Biolabs). Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were coated to dry overnight at 37°C with 400 ng/well of recombinant His-tagged GT198 proteins together with 5 μg/well of purified BSA (NEB) in a volume of 50 μl ...
-
bioRxiv - Cancer Biology 2019Quote: ... were coated to dry overnight at 37°C with 400 ng/well of recombinant His-tagged GT198 proteins together with 5 µg/well of purified BSA (NEB) in a volume of 50 µl ...
-
bioRxiv - Molecular Biology 2021Quote: Biotinylation of SNAP tagged proteins and Avi-tagged proteins were performed as suggested by manufactures (NEB, Avidity). Direct biotinylation of proteins for example-YenB ...
-
bioRxiv - Plant Biology 2023Quote: ... MBP-tagged and GST-tagged proteins were detected using anti-MBP (E8032S, NEB) and anti-GST antibody (60-021 ...
-
bioRxiv - Cell Biology 2024Quote: All purified SNAP-tagged proteins were labeled with 10-fold molar excess of SNAP-Surface dyes (New England Biolabs, Ipswich, MA) in labeling buffer (1× PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells we first created the pHAGE-empty plasmid (pAS4940) by excising the ERBB2 coding sequence from pHAGE-ERBB2 (addgene #116734) using Xho1 (NEB, R0146S) followed by re-ligation of the vector ...
-
bioRxiv - Plant Biology 2021Quote: Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
bioRxiv - Plant Biology 2023Quote: ... SNAP-tagged proteins were labelled with Cell-SiR647 (NEB, Frankfurt, Germany). Labeling was done at RT for 1hr ...
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Genomics 2021Quote: ... The purified recombinant protein or commercial M.EcoGII (NEB, M0603S) was diluted with coating buffer (0.05 M NaHCO3 buffer ...
-
bioRxiv - Genetics 2020Quote: ... MEFs were protein transfected with recombinant RNase H (NEB) using Project Reagent Transfection Kit (Thermo ...
-
bioRxiv - Plant Biology 2019Quote: ... MBP-tagged proteins were purified using amylose resin (New England Biolabs, #E8021S) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... MBP-tagged proteins were purified by amylose affinity chromatography (New England Biolabs) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... and MBP-tagged proteins were purified on Amylose resin (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... GST-tagged proteins were purified on glutathione-Sepharose beads (New England Biolabs), and MBP-tagged proteins were purified on Amylose resin (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... Snap-tagged human β1AR and β2AR constructs were labeled with Snap-cell 647 SiR (New England Biolabs, S9102S) at 1:1000 concentration for 20 min at 37°C in DMEM without phenol red supplemented with 30 mM HEPES ...
-
bioRxiv - Molecular Biology 2022Quote: ... recombinant kinases (2500 U/mg protein for PKA (NEB-P600S), 500:1 Tau:kinase for Gsk3ß (BPS-40007) ...
-
bioRxiv - Cell Biology 2022Quote: ... purified recombinant PKA proteins (2,500 units/ml, New England Biolabs) along with 100 μM cAMP ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant hACE2 protein was digested using EndoH (New England Biolabs) and thrombin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... recombinant proteins were treated with PNGase F (New England Biolabs) according to manufacturer’s instructions ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... The MBP tagged proteins were purified by using Amylose Resin (New England Biolabs) and Ultrafiltration tubes (Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... His- tagged proteins were purified by NEBExpress® Ni-NTA Magnetic Beads (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... new SNAP-tagged histones were pulse-labeled for 30 min with 5 μM final SNAP-biotin (New England Biolabs) diluted 1:200 in 10% Duolink blocking buffer (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant RfxCas13d proteins were expressed in E.coli NiCo21(DE3) (NEB C2529). Cells were grown in 1L of lysogeny (Luria-Bertrani ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were induced in SHuffle Express strains (New England Biolabs) upon addition of 1mM IPTG in cultures containing kanamycin 50 μg/mL and incubated with agitation at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... MBP-tagged CCDC22 and CCDC93 proteins were purified using Amylose beads (New England Biolabs), mixed in approximately 1:1 stoichiometry ...
-
bioRxiv - Cell Biology 2022Quote: ... was expressed as maltose-binding protein-tagged fusion protein using the pMAL(tm)c5X-vector (New England Biolabs, Ipswich, USA). The coding DNA sequence was amplified by PCR using gene-specific primers (for primer sequences ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 µg of purified recombinant WRN protein was treated with Lambda Protein Phosphatase (LPP, New England Biolabs) in 1X PMP buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Immunology 2019Quote: Transient dual knockdown of egfra and erbb2 was induced using a Cas9 nuclease (New England Biolabs) in combination with transactivating RNA (tracr ...
-
bioRxiv - Neuroscience 2022Quote: ... the recombinant proteins were purified by amylose resin (#E8022S, New England Biolabs) according the manual instructions ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GFP-fusion proteins were purified from BL21(DE3) cells (NEB, # C2527H) using an N-terminal H6-tag ...
-
bioRxiv - Biochemistry 2021Quote: Pulldowns of MBP-tagged fusion proteins were performed using an amylose resin (New England Biolabs). Appropriate amounts of (see Fig ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant protein was sequentially purified using an amylose column (New England Biolabs) followed by a nickel-nitrilotriacetic acid column (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... MBP-tagged protein was captured by gravity flow affinity chromatography using amylose resin (New England Biolabs). Captured protein was washed with wash buffer (50mM Tris/HCl pH 7.6 ...
-
bioRxiv - Immunology 2019Quote: ... Gel filtered proteins were labeled with either SNAP-Cell 505 (NEB, catalog S9103S) or SNAP-Cell TMR (NEB ...
-
bioRxiv - Neuroscience 2022Quote: The three NMDAR fusion protein constructs were subcloned into pCSE2.7-mIgG2a-Fc-XP (N1-Fc and N2B-Fc) or pCSE2.8-mIgG2a-Fc-Xp (N1-N2B-Fc) using NcoI/NotI (New England Biolabs, Frankfurt, Germany) for mammalian production in Expi293F cells ...
-
bioRxiv - Plant Biology 2019Quote: ... Recombinant proteins were purified using gravity flow columns with amylose resin (New England Biolabs). MBP cleavage was performed by incubation in cleavage buffer (50 mM Trizma-HCl ...
-
bioRxiv - Plant Biology 2021Quote: Recombinant proteins from Escherichia coli lysates were immobilized on amylose resins (New England Biolabs), incubated for 1 h at 4 °C with purified GST-SH3P2 ...
-
bioRxiv - Plant Biology 2022Quote: ... For recombinant protein expression we used GW versions of pMAL-C2 (New England Biolabs) and pDEST-17 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... The recombinant proteins were affinity purified through GST tag binding to amylose resin (BioLabs) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2021Quote: ... His tagged proteins were eluted with lysis buffer containing 400mM imidazole and bound immediately to amylose resin (NEB) for 1hr ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified protein was labeled with SNAP-Surface Alexa Fluor647 dye (New England Biolabs). The fractional dye labeling and DNA binding activity were assessed as previously described [12].
-
bioRxiv - Microbiology 2021Quote: Recombinant proteins were expressed in Escherichia coli T7 Express lysY/Iq cells (New England Biolabs). For all proteins except PP1γ ...
-
bioRxiv - Cell Biology 2021Quote: ... Ribonucleoprotein (RNP) complexes were formed from sgRNA and recombinant Cas9 2NLS protein (New England Biolabs) mixed at a sgRNA to Cas9 ratio of 4.5 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...