Labshake search
Citations for New England Biolabs :
1 - 50 of 1127 citations for Recombinant Human F3 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Immunology 2024Quote: ... meningosepticum) and Endo F3 (NEB) (designated as F1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human histone H4 (New England Biolabs # M2504S) was used as a substrate ...
-
bioRxiv - Biochemistry 2022Quote: Cysteine mutations were introduced into a pENTR1A FLAG (FT) WT F3 or pENTR1A 3xFT WT F3 plasmid using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA, USA). pENTR1A constructs were shuttled into the pcDNA DEST40 vector (Life Technologies ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Recombinant human Histone H2A (New England BioLabs, Catalog # M2502S) or H4 (New England BioLabs ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of human recombinant histone H4 (BioLabs, Cat# M2504S) was incubated with 50 μM n-butyryl- or isobutyryl-CoA and 0.2 μM of HAT1 at 30 °C for 1 hour ...
-
bioRxiv - Biophysics 2020Quote: Recombinant wild-type human histone H1.0 (New England Biolabs, cat. # M2501S) was used for experiments with fluorescently-labeled nucleosomes ...
-
bioRxiv - Biochemistry 2021Quote: Recombinant human CHIP was expressed in BL21(DE3) (New England Biolabs) E ...
-
bioRxiv - Cell Biology 2024Quote: ... coli-derived recombinant human histone H1 (NEB, Ipswich, MA, USA #M2501), H2A (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The purified recombinant protein or commercial M.EcoGII (NEB, M0603S) was diluted with coating buffer (0.05 M NaHCO3 buffer ...
-
bioRxiv - Genetics 2020Quote: ... MEFs were protein transfected with recombinant RNase H (NEB) using Project Reagent Transfection Kit (Thermo ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Molecular Biology 2022Quote: ... recombinant kinases (2500 U/mg protein for PKA (NEB-P600S), 500:1 Tau:kinase for Gsk3ß (BPS-40007) ...
-
bioRxiv - Cell Biology 2022Quote: ... purified recombinant PKA proteins (2,500 units/ml, New England Biolabs) along with 100 μM cAMP ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant hACE2 protein was digested using EndoH (New England Biolabs) and thrombin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... recombinant proteins were treated with PNGase F (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant RfxCas13d proteins were expressed in E.coli NiCo21(DE3) (NEB C2529). Cells were grown in 1L of lysogeny (Luria-Bertrani ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were induced in SHuffle Express strains (New England Biolabs) upon addition of 1mM IPTG in cultures containing kanamycin 50 μg/mL and incubated with agitation at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... 100 μg of each RBD was treated with endo F3 (purchased from New England Biolabs) in 1x Glycobuffer (50 mM sodium acetate ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 µg of purified recombinant WRN protein was treated with Lambda Protein Phosphatase (LPP, New England Biolabs) in 1X PMP buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... the recombinant proteins were purified by amylose resin (#E8022S, New England Biolabs) according the manual instructions ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GFP-fusion proteins were purified from BL21(DE3) cells (NEB, # C2527H) using an N-terminal H6-tag ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant protein was sequentially purified using an amylose column (New England Biolabs) followed by a nickel-nitrilotriacetic acid column (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the second fragment with aft cDNA F3 (TACCTTCATAGCAAATATGAAAAGGATGAGATTAAATGGCGCTGGCGCTCAACTACTTTG) and aft cDNA R1 (CTCGGTACCAAATACtGCTGCCGACTCTTGGATGGAACCGACATCTG) with Q5 polymerase (NEB), the two PCR fragments were then fused by PCR and cloned with EcoRI and KpnI into the pUC 3GLA vector 45 containing an attB site for phiC31 mediated integration ...
-
bioRxiv - Plant Biology 2019Quote: ... Recombinant proteins were purified using gravity flow columns with amylose resin (New England Biolabs). MBP cleavage was performed by incubation in cleavage buffer (50 mM Trizma-HCl ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant proteins were labeled with SNAP-Surface 549 dye (New England BioLabs, Cat# S9112S) for visualization ...
-
bioRxiv - Plant Biology 2021Quote: Recombinant proteins from Escherichia coli lysates were immobilized on amylose resins (New England Biolabs), incubated for 1 h at 4 °C with purified GST-SH3P2 ...
-
bioRxiv - Plant Biology 2022Quote: ... For recombinant protein expression we used GW versions of pMAL-C2 (New England Biolabs) and pDEST-17 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... The recombinant proteins were affinity purified through GST tag binding to amylose resin (BioLabs) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: Recombinant proteins were expressed in Escherichia coli T7 Express lysY/Iq cells (New England Biolabs). For all proteins except PP1γ ...
-
bioRxiv - Cell Biology 2021Quote: ... Ribonucleoprotein (RNP) complexes were formed from sgRNA and recombinant Cas9 2NLS protein (New England Biolabs) mixed at a sgRNA to Cas9 ratio of 4.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... Bael-GFP-R2) and RHA (Bael-RHA-F3, Bael-RHA-R3) and cloned into pMOD_C0000 using Gibson Assembly® (New England BioLabs). Editing of the repair template by Cas9 was prevented by single base pair substitutions of the PAM sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... CMTr1 was amplified from this cDNA with primers pUAST CG6379HA F2 (CGAACCTTCGGACGATGAGAACTCGGAGCCCACGCCCAAGAAG) and pUAST CG6379 F3 (GCAGAATTCGAGATCTAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACCATGGA CGAACCTTCGGACGATGAGAACTCG) with return primer R5 Spe in a nested PCR with Q5 polymerase (NEB) and cloned with EcoRI and SpeI into a modified pUAST vector containing an attB site for phiC31 mediated integration ...
-
bioRxiv - Microbiology 2022Quote: All recombinant proteins were expressed in Escherichia coli T7 Express lysY/Iq cells (New England Biolabs). Except for GST-PP1γ ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature before being incubated with 1.0 µg/mL of recombinant human histone H3.1 (New England Biolabs, #M2503S) for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant condensin II holo(WT) at 500 nM was mixed with or without λ protein phosphatase (NEB) at a final concentration of 400 U/µL in 1x NEBuffer for Protein MetalloPhosphatases supplemented with 1 mM MnCl2 and incubated at 30°C for 60 min ...
-
bioRxiv - Plant Biology 2023Quote: ... and recombinant MBP-tagged proteins purification were performed according to the manufacturer’s instructions of Amylose Resin (NEB).
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... and 200 μM each of dATP/dCTP/dTTP at 21°C for 10 min and an additional 15 min incubation with 25 nM recombinant human RPA (a gift from Sarah W. Cai) and 0.03 U/μl T4 DNA polymerase (NEB, #M0203) at 37°C ...
-
bioRxiv - Microbiology 2022Quote: DNA from two samples (R-F1-E and S-F3-N) were used for preparing DNA metagenome libraries using NEBNext Ultra DNA Library Prep Kit (NEB, Ipswich, MA) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant fusion proteins were purified via affinity chromatography from bacterial extracts using amylose resin (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... EcoRI sites underlined) and different concentration of recombinant His-SET8 protein (0 to 1.4 μM, New England Biolabs) were incubated for 10 min on ice in 1× GRB binding buffer [20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: NSD1/2 WT and different cancer mutants (3.4 μM) were mixed with recombinant H3.1 protein (1 μg) (purchased from NEB) or recombinant H3.1 mononucleosomes in methylation buffer (50 mM Tris/HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified sgRNAs targeting tlnrd1 and slc45a2 were pooled separately and complexed with recombinant Cas9 protein (New England Biolabs) in vitro using 300mM KCl buffer for 5 minutes at +37°C ...