Labshake search
Citations for New England Biolabs :
1 - 50 of 1122 citations for Recombinant Human CTRL Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human histone H4 (New England Biolabs # M2504S) was used as a substrate ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Recombinant human Histone H2A (New England BioLabs, Catalog # M2502S) or H4 (New England BioLabs ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of human recombinant histone H4 (BioLabs, Cat# M2504S) was incubated with 50 μM n-butyryl- or isobutyryl-CoA and 0.2 μM of HAT1 at 30 °C for 1 hour ...
-
bioRxiv - Biophysics 2020Quote: Recombinant wild-type human histone H1.0 (New England Biolabs, cat. # M2501S) was used for experiments with fluorescently-labeled nucleosomes ...
-
bioRxiv - Biochemistry 2021Quote: Recombinant human CHIP was expressed in BL21(DE3) (New England Biolabs) E ...
-
bioRxiv - Cell Biology 2024Quote: ... coli-derived recombinant human histone H1 (NEB, Ipswich, MA, USA #M2501), H2A (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The purified recombinant protein or commercial M.EcoGII (NEB, M0603S) was diluted with coating buffer (0.05 M NaHCO3 buffer ...
-
bioRxiv - Genetics 2020Quote: ... MEFs were protein transfected with recombinant RNase H (NEB) using Project Reagent Transfection Kit (Thermo ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Molecular Biology 2022Quote: ... recombinant kinases (2500 U/mg protein for PKA (NEB-P600S), 500:1 Tau:kinase for Gsk3ß (BPS-40007) ...
-
bioRxiv - Cell Biology 2022Quote: ... purified recombinant PKA proteins (2,500 units/ml, New England Biolabs) along with 100 μM cAMP ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant hACE2 protein was digested using EndoH (New England Biolabs) and thrombin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... recombinant proteins were treated with PNGase F (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant RfxCas13d proteins were expressed in E.coli NiCo21(DE3) (NEB C2529). Cells were grown in 1L of lysogeny (Luria-Bertrani ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were induced in SHuffle Express strains (New England Biolabs) upon addition of 1mM IPTG in cultures containing kanamycin 50 μg/mL and incubated with agitation at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 µg of purified recombinant WRN protein was treated with Lambda Protein Phosphatase (LPP, New England Biolabs) in 1X PMP buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... the recombinant proteins were purified by amylose resin (#E8022S, New England Biolabs) according the manual instructions ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GFP-fusion proteins were purified from BL21(DE3) cells (NEB, # C2527H) using an N-terminal H6-tag ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant protein was sequentially purified using an amylose column (New England Biolabs) followed by a nickel-nitrilotriacetic acid column (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
bioRxiv - Plant Biology 2019Quote: ... Recombinant proteins were purified using gravity flow columns with amylose resin (New England Biolabs). MBP cleavage was performed by incubation in cleavage buffer (50 mM Trizma-HCl ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant proteins were labeled with SNAP-Surface 549 dye (New England BioLabs, Cat# S9112S) for visualization ...
-
bioRxiv - Plant Biology 2021Quote: Recombinant proteins from Escherichia coli lysates were immobilized on amylose resins (New England Biolabs), incubated for 1 h at 4 °C with purified GST-SH3P2 ...
-
bioRxiv - Plant Biology 2022Quote: ... For recombinant protein expression we used GW versions of pMAL-C2 (New England Biolabs) and pDEST-17 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... The recombinant proteins were affinity purified through GST tag binding to amylose resin (BioLabs) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... of Cas9-CTRL or Cas9-RHO infected retinae using Q5 High-Fidelity DNA Polymerase (New England Biolabs) with primer-F1 ACCTTGGGACAGACAAGCCA and primer-R1 TTTCCGAGGGAAACAGAGGC ...
-
bioRxiv - Microbiology 2021Quote: Recombinant proteins were expressed in Escherichia coli T7 Express lysY/Iq cells (New England Biolabs). For all proteins except PP1γ ...
-
bioRxiv - Cell Biology 2021Quote: ... Ribonucleoprotein (RNP) complexes were formed from sgRNA and recombinant Cas9 2NLS protein (New England Biolabs) mixed at a sgRNA to Cas9 ratio of 4.5 ...
-
bioRxiv - Microbiology 2022Quote: All recombinant proteins were expressed in Escherichia coli T7 Express lysY/Iq cells (New England Biolabs). Except for GST-PP1γ ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature before being incubated with 1.0 µg/mL of recombinant human histone H3.1 (New England Biolabs, #M2503S) for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant condensin II holo(WT) at 500 nM was mixed with or without λ protein phosphatase (NEB) at a final concentration of 400 U/µL in 1x NEBuffer for Protein MetalloPhosphatases supplemented with 1 mM MnCl2 and incubated at 30°C for 60 min ...
-
bioRxiv - Plant Biology 2023Quote: ... and recombinant MBP-tagged proteins purification were performed according to the manufacturer’s instructions of Amylose Resin (NEB).
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... and 200 μM each of dATP/dCTP/dTTP at 21°C for 10 min and an additional 15 min incubation with 25 nM recombinant human RPA (a gift from Sarah W. Cai) and 0.03 U/μl T4 DNA polymerase (NEB, #M0203) at 37°C ...
-
bioRxiv - Pathology 2023Quote: Total RNA extracted from hearts of Ctrl and Eprs1cKO-homoat 2 weeks post tamoxifen injection were treated with DNase I (NEB) to remove potential genomic DNA in the RNA samples ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant fusion proteins were purified via affinity chromatography from bacterial extracts using amylose resin (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... EcoRI sites underlined) and different concentration of recombinant His-SET8 protein (0 to 1.4 μM, New England Biolabs) were incubated for 10 min on ice in 1× GRB binding buffer [20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: NSD1/2 WT and different cancer mutants (3.4 μM) were mixed with recombinant H3.1 protein (1 μg) (purchased from NEB) or recombinant H3.1 mononucleosomes in methylation buffer (50 mM Tris/HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified sgRNAs targeting tlnrd1 and slc45a2 were pooled separately and complexed with recombinant Cas9 protein (New England Biolabs) in vitro using 300mM KCl buffer for 5 minutes at +37°C ...
-
bioRxiv - Neuroscience 2022Quote: All anti-tau monoclonal antibodies were generated by the hybridoma approach against recombinant tau aggregates (human full-length tau) encapsulated in the ACM Polymersomes (ACM Biolabs, Singapore) and purified by size exclusion chromatography (SEC ...
-
bioRxiv - Molecular Biology 2019Quote: ... After annealing the complex an equimolar amount was mixed with 1000ng Cas9 recombinant protein (NEB; final conc 20ng/ul) and incubated at RT for 15’ ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant C-terminally FLAG-Tagged TEX264 was produced by PURExpress in vitro protein synthesis kit (E6800; New England Biolabs). Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B ...
-
bioRxiv - Genetics 2019Quote: P2C-Cas9 and P2C-EGFP proteins were expressed from pET28a-P2C-Cas9 and pRSET-P2C-EGFP respectively by recombinant BL21 E.coli (NEB) as described in detail in Chaverra-Rodriguez et al ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 μg each of the recombinant proteins were lyophilized and digested with PNGase F (P0701S, New England Biolabs Inc.) according to the manufacture’s instruction ...