Labshake search
Citations for New England Biolabs :
1 - 50 of 9896 citations for QuantiFluo Caspase 3 Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Purified mIL-12bC197S-His6 in complex with mIL-12Rβ1D1-D2-His6 was subjected to an overnight Caspase-3 and EndoH (New England Biolabs) digest (1/100 w/w ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’-CTTTTGACATCCGCTTCTGC-3’ followed by a T7 endonuclease assay (NEB) to detect indels ...
-
bioRxiv - Immunology 2019Quote: ... The culture supernatant was projected to perform luciferase assay with Gaussia Luciferase assay kit and Cypridina Luciferase assay kit (NEB) following their description.
-
bioRxiv - Cell Biology 2023Quote: ... The Oxiselect Comet Assay Kit (Cell-Biolabs) was used as a reference for the experiment ...
-
bioRxiv - Immunology 2022Quote: ... Caspase-11 catalytic (C254A) and cleavage (D285A) mutants were generated by site-directed mutagenesis (Q5 SDM Kit, New England BioLabs; #E0554S) of the wild-type parent vector according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the BioLux® Gaussia Luciferase Assay Kit (NEB, discontinued) or the GAR-2B Gaussia Luciferase Assay (Targeting Systems ...
-
bioRxiv - Molecular Biology 2020Quote: ... the 3’ adapter was first ligated using 0.5 μl of 3’SR Adapter for Illumina (NEB-kit) added to 30 ng of input RNA diluted in 3.0 μl nuclease free H2O ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit) were added and incubated for 18 h at 16°C over-night ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Cypridina Luciferase Assay Kit (New England Biolabs) and Gaussia luciferase was assayed from 1:40 diluted cell culture supernatant using either the Stop & Glo reagent from the DualLuciferase® Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Gaussia Luciferase Assay Kit (New England Biolabs) in a Lumat LB 9507 luminometer (Berthold Technologies).
-
bioRxiv - Microbiology 2021Quote: ... or a Biolux Gaussia luciferase assay kit (New England BioLabs) and a GloMax microplate reader (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... The parental caspase-1 plasmid (methylated) was digested using DpnI (NEB; Cat,# R0176S). Plasmids were transformed in E.coli DH5α competent cells (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2020Quote: ... For 3’ adaptor ligation the NEBNext Small RNA Kit (E7560S, NEB) was used ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Biophysics 2022Quote: ... the purified 8.2 kb DNA linker was annealed to the oligo DNA handle with 3’-biotin (5’-TGGACTGATGCGGTATCTGCGATATCCTA CGCAGGCGTTT-3’-biotin) in PBS at room temperature for 3 hr followed by purification using Monarch DNA purification kit (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... PCR mutagenesis to create site-directed mutants of malM 3’-UTR and cspE 3’-UTR was conducted with the Q5 site-directed mutagenesis kit (New England Biolabs) using end-to-end primers designed with NEBaseChanger ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligas’ 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2019Quote: ... Assays were performed using NEB BioLux Gaussia Luciferase (GLuc) kit (NEB #E3300L) following the stabilized protocol ...
-
bioRxiv - Microbiology 2024Quote: In vitro transcription/translation assays were conducted using the PURExpress kit (NEB) according to the manufacturer’s protocol with a 2-hour incubation at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Microbiology 2019Quote: ... the 3’ adapter-ligated DNA fragments were adenylated using 5’ DNA Adenylation Kit (NEB) in a 20-μl reaction following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: Coupled transcription-translation assays were carried out with the PURExpress kit (New England BioLabs) as described in (Lukasiewicz and Contreras ...
-
bioRxiv - Biochemistry 2023Quote: ... Assays were set-up using PURExpress in vitro protein synthesis kit (New England Biolabs) with a cloned full-length DHFR template ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was purified by silica-based SPE using Monarch RNA Cleanup Kits (for in vitro assays) or Total RNA Miniprep Kit for intracellular samples (NEB).
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... rRNA was removed from 3 replicates with NEBNext Bacteria rRNA Depletion Kit (New England Biolabs), while the other 3 were treated with NEBNext Depletion Core Reagent Set using custom probes targeted to Haloferax volcanii rRNA (Martinez-Pastor and Sakrikar ...
-
bioRxiv - Microbiology 2021Quote: ... coli MG1655 genomic DNA into pKK223-3 by NEBuilder HiFi DNA Assembly Cloning Kit (NEB) and the first 300 bp portion of leuA was translationally fused with the nano-Luc (nLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... A18-Y260A-SDM-Rev (5’-CGTTGTGTAACCAGGAGAATG-3’) and Q5 site directed mutagenesis kit (NEB E0554). This LT3N1-GPIR-Arhgef18 vectors were further modified to substitute EGFP with 3XHA-FLAG tag ...
-
bioRxiv - Microbiology 2023Quote: ... Nef deletion Reverse: 5’-AGATCTACAGCTGCCTTGTAAGTCATTGG-3’) using Q5® Site-Directed Mutagenesis Kit (NEB #E0554S).
-
bioRxiv - Microbiology 2023Quote: ... The 3 fragments were ligated using the Gibson Assembly® Cloning Kit (New England Biolabs). The created pEXG2::ΔfahA and pEXG2::ΔpanC were transformed into E ...
-
bioRxiv - Immunology 2021Quote: We quantified plasma luciferase activity by a BioLux Gaussia Luciferase Assay Kit (NEB, Ipswich, MA) from 10 μL plasma acquired by retro-orbital bleeding ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the High Sensitivity DNA Assay and NEBNext Library Quant Kit for Illumina (NEB, E7630). Finally ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μg of total RNA was reverse transcribed using LunaScript cDNA Synthesis Kit (New England Biolabs). Gene-expression levels were quantified by real-time quantitative PCR (iCycler iQ BioRad ...
-
bioRxiv - Synthetic Biology 2020Quote: ... GLuc activity in samples was measured using the Biolux Gaussia Luciferase Assay kit (NEB, Ipswich, MA). GLuc assay solution (50 μL ...