Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Protein DNA Interaction Assay since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mg of cell lysate was cleared with protein A magnetic beads to remove non-specific interactions (S1425S, NEB) and incubated overnight with anti-ZAP antibody (Proteintech 16820-1-AP ...
-
bioRxiv - Bioengineering 2024Quote: DNA cutting assays were performed following New England Biolabs (NEB) method.39,40 Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... The donor DNA (0.6μM) with Cas9 protein (NEB #M0646T), crRNA and tracrRNA were injected in a 1:1:1:1 molar ratio into mouse zygotes by the UCSD Transgenic and Knockout Mouse Core (See Supplementary Table 4 for crRNA sequence) ...
-
bioRxiv - Microbiology 2022Quote: BACTH constructs made for homo- and heterotypic interaction analysis were created using the HiFi Cloning (NEB) protocol ...
-
bioRxiv - Bioengineering 2020Quote: To prepare the DNA template for curtain assays λDNA (125 μg, NEB) was incubated with 2 μΜ biotinylated oligo complementary to one of the two 12 nt cohesive ends in λDNA in T4 DNA ligase reaction buffer (NEB ...
-
bioRxiv - Cell Biology 2020Quote: All in vitro kinase assays were done in NEBuffer for protein kinase (NEB) at 30°C ...
-
bioRxiv - Biophysics 2021Quote: ... 100μg/ml single stranded DNA binding protein (gp32) from T4 (NEB), 277μg/ml T4 DNA clamp ...
-
bioRxiv - Immunology 2022Quote: ... integrated HIV DNA and unspliced HIV RNA was performed by modified nested real-time PCR assay using Taq DNA polymerase (BioLabs) in the first PCR and TaqMax Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Plant Biology 2020Quote: Recombination assays were performed with single-strand linear ΦX174 virion DNA and double strand circular ΦX174 RFI DNA (New England Biolabs) linearized with PstI in 20 mM Tris-acetate pH 7.4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein amounts for deadenylation assays were estimated against BSA standards (New England Biolabs, B9000S).
-
bioRxiv - Biochemistry 2023Quote: ... Assays were set-up using PURExpress in vitro protein synthesis kit (New England Biolabs) with a cloned full-length DHFR template ...
-
bioRxiv - Molecular Biology 2022Quote: DNA substrates for gel shift assays were amplified by PCR using Q5 Polymerase (NEB) and purified using a DNA Clean and Concentrator kit (Zymo Research) ...
-
bioRxiv - Biophysics 2022Quote: ... The generated DNA tether was then ligated to the DNA-protein hybrid by overnight incubation with T4 ligase (New England Biolabs) at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Template DNA for in vitro protein synthesis was generated with Phusion® Hot Start Flex DNA Polymerase (NEB. Ipswich MA) using gBlocks as template and flanking primers (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the High Sensitivity DNA Assay and NEBNext Library Quant Kit for Illumina (NEB, E7630). Finally ...
-
bioRxiv - Genomics 2021Quote: - Extreme Thermostable Single-Stranded DNA Binding Protein (ET SSB, 500 ng/μL, NEB) was tested in 4 different amounts ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4.2 ng/μl extreme thermostable single-stranded DNA binding protein (New England Biolabs) and 0.02 U/μl SuperFi DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2019Quote: Assays were conducted by incubating 0.1 and 1 μM SidJ in 1X Protein Kinase buffer (NEB), with 10 mM CaCl2 ...
-
bioRxiv - Biochemistry 2023Quote: DNA templates for the transformation assays were prepared by PCR amplification from the pUC19 plasmid (NEB), after which the PCR fragments were Dpn1-treated ...
-
bioRxiv - Biochemistry 2019Quote: ... The assay was performed using the PURExpress In Vitro Protein Synthesis Kit (E6800S New England Biolabs, Inc.), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 - 400 ng of PCR fragments were used as template DNA to synthesize analytic amounts of DNA deaminases using PURExpress In Vitro Protein Synthesis kit (NEB, Ipswich, MA) following manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2021Quote: ... The binding assay was performed by incubating these radiolabelled DNA fragments with RNA polymerase holoenzyme (NEB #MO551S) for 5min at 25 °C followed by loading in 4% polyacrylamide gel in 1X TBE buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described earlier18,19,41,42 using Long Amp Taq DNA Polymerase (New England BioLabs). Three transcribed (HPRT ...
-
bioRxiv - Biophysics 2020Quote: ... The overhang DNA was added to the protein-oligo chimera together with T4 ligase (NEB) and incubated for 30 min at 16°C followed by 30 min on ice ...
-
bioRxiv - Biophysics 2022Quote: Plasmids expressing stdMCP-fusion proteins were generated using the NEBuilder HiFi DNA Assembly kit (NEB). To obtain plasmids carrying an stdGFP-tagged stdMCP gene ...
-
bioRxiv - Cancer Biology 2020Quote: ... on ice for 30 min and protein concentration measured by BCA assay (7780, New England Biolabs, Beverly, USA). Results were analyzed using the Compass software (ProteinSimple) ...
-
bioRxiv - Molecular Biology 2022Quote: LAMP assays were optimized with Loxosceles similis DNA using Master Mix reagent (WarmStart® #M1800 – New England BioLabs). For this ...
-
bioRxiv - Microbiology 2020Quote: All the templates required for the assay were labelled with [γ-32P] ATP using T4 DNA ligase (NEB) at room temperature for 1 h ...
-
bioRxiv - Bioengineering 2024Quote: ... In vitro cleavage reactions were performed on the circularized DNA using SpCas9 protein (NEB, Ipswich, MA) and KLRC1 sgRNA ...
-
bioRxiv - Biochemistry 2020Quote: The total volume of CRISPR Cas12a-based cleavage assay was 20 μL including LbCas12a protein (New England BioLabs, Inc.), crRNA ...
-
bioRxiv - Molecular Biology 2023Quote: LAMP assays were developed with the Warm Start Colorimetric LAMP 2X Master Mix (DNA & RNA) (New England Biolabs, USA), using a mixture of LAMP oligonucleotides at a final concentration of 1.6 μM FIP and BIP ...
-
bioRxiv - Bioengineering 2022Quote: ... In vitro Cas9 cleavage assay was carried out using purified IVT product and Cas9 protein (Cas9 Nuclease, S. pyogenes, New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Equal volumes of each immunoprecipitated sample were then aliquoted into two tubes and beads were then resuspended with 100 microliters of lambda phosphatase assay buffer containing 400 units of lambda protein phosphatase (NEB), or with 100 microliters of lambda phosphatase assay buffer alone ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins from the supernatant at 2 mg/mL were used for the Co-IP assay using Protein G magnetic beads (New England Biolabs) and a mouse monoclonal anti-HA antibody (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... proteins are recovered by digesting the DNA with the PtsI restriction enzyme (New England Biolabs, Ipswich, MA), whose cut site was incorporated into all designed oligos.
-
bioRxiv - Microbiology 2020Quote: ... Final Illumina libraries were assessed for quality using an Agilent Bioanalyzer DNA High Sensitivity Assay and qPCR quantification was performed using NEBNext Library Quant kit for Illumina (New England Biolabs). Individual libraries were pooled equimolarly ...
-
bioRxiv - Molecular Biology 2021Quote: LAMP assay was performed in a total volume of 25 μl with Bst 2.0 WarmStart™ DNA Polymerase (New England Biolabs). The reagents ...
-
bioRxiv - Genetics 2019Quote: ... in accordance with the manufacturer’s recommendations and were validated using the Agilent High Sensitivity DNA assay on the Agilent Bioanalyzer 2100 system and quantified by NEBNext Library Quant Kit for Illumina (New England Biolabs). After clustering of the index-coded samples ...
-
bioRxiv - Cell Biology 2023Quote: ... we quantitated the proportion of abnormal DNA fragments generated by the procedure using DNA prepared from the transfected cell population and a polymerase chain reaction (PCR)-based T7 endonuclease assay (New England BioLabs). The PCR was performed with primers flanking the predicted ligation-junction product (forward primer AGAATACCAGGGGGCCATGA and reverse primer AACGAATCCTTTCCCTGGGTC) ...
-
bioRxiv - Biochemistry 2020Quote: In vitro trans-translation assays were performed using the PURExpress In Vitro Protein Synthesis and Δ Ribosome kits (New England Biolabs). For trans-translation assays ...
-
bioRxiv - Molecular Biology 2020Quote: ... σA-FLAG and RbpA-FLAG proteins were prepared by PCR using Q5® High-Fidelity DNA Polymerase (NEB) with primers #3130 + #3131 (HelD) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Genomics 2022Quote: ... The DNA substrates for in vitro cleavage assays were synthesized using Phusion® Hot Start Flex 2X Master Mix (NEB, M0536S) and purified using GeneJET PCR Purification Kit (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA obtained from the ChIP-assays was adaptor-ligated and amplified using the NEBNext multiplex oligo kit (New England BioLabs, E7335S) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from three pooled killing assay spots (as detailed in the previous section) utilizing the Monarch® Genomic DNA Purification Kit (NEB). Quantification of genomic DNA copies was targeted at the kdpAB gene and carried out with the Naica® Crystal Digital PCR System using Sapphire chips (Stilla Technologies).
-
bioRxiv - Genetics 2020Quote: ... and resuspended in 750 µl ligation mixture containing 200 units T4 DNA ligase (NEB/ IMB core facility protein production), 1X T4-Ligation buffer (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... The purified target PCR amplicon was incubated with purified recombinant wt- or en-Cas12a protein and crRNA (RNA-guides or chimeric DNA-RNA guides) in 10X buffer (NEBuffer3.1, NEB) for 1 h ...
-
bioRxiv - Biophysics 2023Quote: ... and DNA-bound proteins were released by MNase treatment (2 min 30° with 700 units of MNase NEB # M0247S) and analyzed by gel electrophoresis40.
-
bioRxiv - Microbiology 2021Quote: ... the DNA products from each ChIP assay were first end repaired with end repair enzyme mix (New England Biolabs, Inc., Cat#M6630), then ligated to NEBNext adaptor included in the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (Cat#E7645L ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as wildtype (WT) N2aC were assayed for mis-matched DNA pairs via T7 endonuclease assay (EnGen Mutation Detection Kit; New England Biolabs, Ipswich, MA) with PCR primers targeted towards our genomic region of interest (Integrated DNA technologies ...