Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Plant DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: Monarch Genomic DNA Purification kit (NEB)
-
bioRxiv - Genomics 2023Quote: Monarch Genomic DNA Purification Kit (NEB T3010S)
-
bioRxiv - Bioengineering 2021Quote: Genomic DNA was extracted using Monarch Genomic DNA Purification Kit (NEB) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using the Monarch Genomic DNA Purification Kit (NEB) according to the manufacturer guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using the Monarch Genomic DNA Purification Kit (NEB) according to the manufacturer guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... or 3 * 106 cells with the lowest or highest 5% of Spry4:H2B-Venus fluorescence were FAC sorted and their DNA isolated by column-based genomic DNA purification (Monarch Genomic DNA Purification Kit, NEB). For reference ...
-
bioRxiv - Genetics 2022Quote: Genomic DNA was isolated using the Monarch Genomic DNA Purification Kit (NEB) Sample Lysis ...
-
bioRxiv - Cancer Biology 2023Quote: ... The DNA was purified using Monarch DNA purification kit (Cat # T1030, NEB) and quantified by Qubit high-sensitivity DNA kit (Cat # Q33230 ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was purified using a PCR purification kit (NEB) following manufacturer instructions.
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated from blood (QiaAmp DNA Mini Blood Kit, Qiagen; or Monarch Genomic DNA purification kit, NEB) or from perfused organs homogenized (Fisher Bead Mill 4 ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from single-colony cultures (Monarch Genomic DNA Purification Kit, NEB). Short read libraries were prepared based on the NEBNext Ultra II FS DNA Library Prep with Sample Purification Beads (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... cell DNA was extracted using the Monarch genomic DNA purification kit (NEB #T3010L) or the NucleoSpin Tissue kit (Macherey-Nagel #740952-250 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The genomic DNA was extracted using Monarch Genomic DNA purification kit (NEB T3010). Two rounds of amplification for gRNA from the genomic DNA were performed ...
-
bioRxiv - Molecular Biology 2023Quote: ... the genomic DNA was extracted using Monarch Genomic DNA purification kit (NEB T3010) followed by PCR amplification of the gRNA cassette using primers compatible with Illumina sequencing and NEB Q5 Hot Start High-Fidelity master mix (NEB M0494 ...
-
bioRxiv - Genomics 2021Quote: ... After purification with Monarch PCR & DNA Cleanup kit (NEB, #T1030S), libraries were indexed using NEBNext Multiplex Oligos (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was purified using a Monarch PCR purification kit (NEB). qPCR for three independent replicates was performed using iQ SYBR Green Supermix (Biorad ...
-
bioRxiv - Synthetic Biology 2021Quote: ... treatment and DNA purification with Monarch Plasmid Miniprep kit (NEB), or (ii ...
-
bioRxiv - Microbiology 2022Quote: ... using Monarch® Genomic DNA Purification Kits (New England Biolabs), and viral genome copies quantified by qPCR of the viral gene ORF57 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... After purification using Monarch® PCR & DNA Cleanup kit (NEB), the templates were transcribed ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were purified with a DNA purification kit (NEB) and were then phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2023Quote: ... the Monarch® Genomic DNA Purification Kit (NEB, Cat# T3010) was used (10 µl Proteinase K ...
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted using the Monarch Genomic DNA purification kit (New England Biolabs). 400ng genomic DNA was used to construct whole-genome bisulfite libraries ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA purification was performed using the Monarch PCR & DNA Cleanup Kit (NEB, Ipswich, USA). Libraries were then amplified and purified before being size selected using magnetic AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted using Monarch® Genomic DNA purification kit (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the DNA was extracted by using Monarch® Genomic DNA Purification Kit (NEB, T3010S). For the analysis of microdeletions of the targeted exons an Out-Fwd (p1 GCACAGTCAGACCACAGTCACC ...
-
bioRxiv - Molecular Biology 2023Quote: DNA from positive clones was extracted using a Monarch Genomic DNA Purification kit (NEB). DNA insertion was confirmed by amplification of a fragment including both genomic and kanamycin resistance cassette sequences followed by the sequencing of amplified DNA (Macrogen).
-
bioRxiv - Synthetic Biology 2023Quote: ... after which DNA was extracted using Monarch genomic DNA purification kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... followed by purification with Monarch® PCR & DNA Cleanup Kit (NEB). The Mobius Assemblies were verified first by colony PCR using GoTaq® Green Master Mix (Promega ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by purification using a Monarch PCR&DNA Cleanup Kit (NEB). Ring-ligation was carried out using T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: DNA was purified using the Monarch® Genomic DNA Purification kit (New England BioLabs, T3010S). DNA immunoprecipitation and sequencing was performed as previously described ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: DNA from human cells was isolated using the Monarch®Genomic DNA Purification Kit (NEB) following the manufacturer’s instructions and including the recommended RNaseA digestion step ...
-
bioRxiv - Genomics 2023Quote: ... and DNA was immediately isolated using the Monarch Genomic DNA Purification Kit (NEB, Cat # T3010S), with the modification that elution was carried out with 50 µL 25 mM K3BO3 solution (pH 7.0).
-
bioRxiv - Genomics 2023Quote: ... and DNA was immediately isolated using the Monarch Genomic DNA Purification Kit (NEB, Cat # T3010S), with the modification that elution was carried out with 87.5 μL 25 mM K3BO3 solution (pH 7.0).
-
bioRxiv - Evolutionary Biology 2024Quote: Short molecular DNA was extracted using the Monarch Genomic DNA Purification kit (New England BioLabs). DNA quality and integrity were assessed with a Nanodrop and an Agilent 5400 ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli C2566 genomic DNA was purified using Monarch Genomic DNA Purification Kit (NEB Ipswich, MA), GM12878 genomic DNA was obtained from Coriell Cell Repositories (Camden ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA was subsequently extracted from T0 plants using Monarch DNA extraction kits (New England Biolabs, Ipswich, MA, USA) and sequence confirmed (CHU de Québec-Université Laval ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was isolated using a genomic DNA extraction kit (Monarch Genomic DNA Purification Kit, New England Biolabs, Frankfurt am Main, Germany) and the PCR was optimized to yield a single amplicon ...
-
bioRxiv - Cell Biology 2019Quote: ... then purified with Monarch PCR & DNA Purification Kit (New England BioLabs, T1030S) followed by T4 DNA Ligase reaction (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... The DNA was extracted with NEB Monarch gel purification kit (NEB, T1020S) using two columns and eluted in 30 µL of the elution buffer.
-
bioRxiv - Microbiology 2023Quote: ... purification (Monarch PCR & DNA Cleanup Kit, New England Biolabs Cat. No. T1030), and ligation with T4 DNA ligase (New England Biolabs Cat ...
-
bioRxiv - Bioengineering 2024Quote: ... gDNA extraction using Monarch® Genomic DNA Purification Kit (New England Biolabs), and histology sectioning.
-
bioRxiv - Bioengineering 2024Quote: ... gDNA extraction using Monarch® Genomic DNA Purification Kit (New England Biolabs), and histology sectioning.
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... Genomic DNA (gDNA) was extracted using the Monarch Genomic DNA Purification Kit (New England BioLabs, #T3010S) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and genomic DNA was extracted by using a Monarch Genomic DNA Purification Kit (New England Biolabs). The thyA gene region was amplified from the genomic DNA (5 ng ...
-
bioRxiv - Molecular Biology 2022Quote: ... and genomic DNAs were extracted by using a Monarch Genomic DNA Purification Kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was extracted from cell pellets using Monarch Genomic DNA Purification Kits (New England Biolabs) and viral episome copies quantified by qPCR of the viral gene ORF57 as described in the qRT-PCR method.
-
bioRxiv - Developmental Biology 2023Quote: ... DNA purification was performed with the Monarch PCR & DNA Cleanup kit (New England Biolabs, Ipswich, MA), or the DNA Clean & Concentrator Kit (Zymo Research) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we isolated high molecular weight DNA by following the Monarch T3010 DNA purification kit (NEB, USA) protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was extracted from ear punch biopsies using the Monarch Genomic DNA purification kit (NEB). Transgenes were identified using PCR primers specific for each transgene (Suppl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted using the Monarch® Genomic DNA Purification Kit (New England Biolabs, Massachusetts; #T3010) with the Monarch® gDNA Tissue Lysis Buffer (#T3011 ...