Labshake search
Citations for New England Biolabs :
1 - 50 of 158 citations for Phospho Tau antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used for immunoblots in this study were anti-tau (tau46) (1:5000; NEB 4019S), anti-human tau (tau13 ...
-
bioRxiv - Neuroscience 2022Quote: All anti-tau monoclonal antibodies were generated by the hybridoma approach against recombinant tau aggregates (human full-length tau) encapsulated in the ACM Polymersomes (ACM Biolabs, Singapore) and purified by size exclusion chromatography (SEC ...
-
bioRxiv - Bioengineering 2019Quote: Deglycosylation of yeast surface displayed tau was performed using PNGase (New England Biolabs (NEB), Cat ...
-
bioRxiv - Bioengineering 2019Quote: Deglycosylation of yeast surface displayed tau was performed using PNGase (New England Biolabs (NEB), Cat ...
-
bioRxiv - Neuroscience 2020Quote: cDNA of tau 151-254 was inserted into a pMCSG17 plasmid using HiFi assembly (NEB #E2621S). The resulting vector encoded a protein consisting of a hexahistidine tag followed tobacco etch virus (TEV ...
-
bioRxiv - Developmental Biology 2023Quote: ... -phospho-histone H3 (1:300, New England BioLabs), -c-Fos (1:1000 ...
-
bioRxiv - Physiology 2020Quote: ... phospho-AKT (#9271, 1:1000, Cell signalling, NEB, UK), total-AKT (#9272 ...
-
bioRxiv - Biochemistry 2019Quote: ... only the cells expressing iRFP-tau WT were treated with 2 U/μL λPP (New England Biolabs # P0753) for 3 hours at 30 °C with gentle rotating ...
-
bioRxiv - Cell Biology 2022Quote: ... P301L/V337M)-EYFP plasmids after the Tau sequence using the Q5 site directed mutagenesis (SDM) kit (New England Biolabs). Tau fragments were subcloned into pcDNA3.1 by restriction digestion and further into pCW57.1- MAT2A all-in-one tet-off lentiviral backbone (a gift from David Sabatini (Addgene plasmid # 100521))71 by Gibson assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid was made by inserting the TauRD sequence (Tau amino acids 244-371) in pHUE82 by Gibson assembly using the Gibson Assembly Master Mix (New England Biolabs). Plasmid pHUE-TauRD (C291A/P301L/C322A/V337M ...
-
bioRxiv - Biophysics 2023Quote: Tau was phosphorylated in vitro according to previous protocols with some modifications.12,88 50 µL of 100 µM tau was incubated with 2 µg cAMP-dependent Protein Kinase (PKA, New England BioLabs P6000S) and/or 0.4 µg GSK3β (Sigma-Aldrich G4296 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and anti-Phospho-histone H3 1:100 (New England Biolabs, Ipswich, USA) and secondary antibodies AlexaFluorTM 488 goat anti-chicken and AlexaFluorTM 594 goat anti-rabbit IgG (Life Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cost of Phospho-RNA-seq was estimated using T4 polynucleotide kinase (NEB, M0201S) and TruSeq small RNA kit (Illumina ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... Constructs expressing GFP-tagged or HA-tagged Shank3 phospho-mutants were generated using the Gibson Assembly kit (NEB) with the wild-type Shank3 as the template ...
-
bioRxiv - Microbiology 2022Quote: ... EE62/63AA and the 2_87 double serine phospho-mimetic SE53/57EE or “SS-EE”) using Phusion-II polymerase (New England Biolabs) and standard protocols ...
-
bioRxiv - Molecular Biology 2019Quote: ... All the pCMV and pcDNA3.1-myc-eIF6 phospho-site mutants were generated using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) using the forward and reverse primers listed in Appendix Table S1 ...
-
bioRxiv - Cell Biology 2023Quote: ... and GST-Elm1-R (GATGCGGCCGCTCGAGCTATATTTGACCATTATCTGCAAAG) to amplify each Elm1 phospho-mutant and cloned into pGEX-4T1 using BamHI and XhoI (New England Biolabs). All plasmid constructs and mutagenesis were confirmed correct via sequencing at the DNA Sequencing Facility ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).
-
bioRxiv - Cancer Biology 2019Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibody (New England BioLabs). An InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibodies (New England BioLabs), and analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Kcr antibody (PTM Biolabs, PTM502), anti-Ub antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bound antibodies were detected by incubation with anti-rabbit DyLight 800-conjugated secondary antibody (New England BioLabs). Slides were analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bound antibodies were detected by incubation with anti-rabbit DyLight 800-conjugated secondary antibody (New England BioLabs). Slides were analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Molecular Biology 2021Quote: Myc-Tag (9B11) antibody (NEB 2276 S) and mouse IgG (Santa Cruz sc-2025 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs), or mouse monoclonal anti-β-actin antibody (A5316 ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-butyryllysine antibody (PTM BioLabs, PTM#301) at 1:2000 dilution was incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies used were: New England Biolabs (NEB), Hitchin ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Microbiology 2019Quote: ... and detected using anti-MBP antibodies (New England Biolabs).
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Developmental Biology 2019Quote: ... incubated overnight with anti-SNAP antibody (NEB, Ipswich, MA), washed and probed with goat-anti-rabbit horseradish peroxidase secondary antibody (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected using the anti-MBP-HRP antibody (NEB). The bound protein (~42kDa ...
-
bioRxiv - Neuroscience 2022Quote: ... and probed with p62 antibody (NEB D5L7G, 1:800) and streptavidin-594 (Biolegend 405240 ...
-
bioRxiv - Neuroscience 2023Quote: ... TCF/LEF family antibody sampler kit (New England BioLabs), NFAT1 (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2022Quote: Anti-M13-pIII monoclonal antibody (E8033S, New England Biolabs), sheep anti-mouse IgG (H/L):HRP (AAC10P ...
-
bioRxiv - Plant Biology 2023Quote: ... after which an anti-p42/p44-erk antibody (NEB) was employed to detect the activated MAPKs on western blots.
-
bioRxiv - Cell Biology 2023Quote: ... anti-SNAP-tag antibody (New England Biolabs, Ref. P9310S), anti-clathrin heavy chain antibody (BD Bioscience ...
-
bioRxiv - Microbiology 2024Quote: ... and detected using anti-MBP antibodies (New England Biolabs). As a negative control ...
-
bioRxiv - Bioengineering 2020Quote: Antibodies were first digested with PNGase F (New England Biolabs) according to the manufacturer’s instructions ...