Labshake search
Citations for New England Biolabs :
1 - 50 of 167 citations for Non Ab Component of Alzheimer's Disease Amyloid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and mutated by PCR to generate the disease variant alleles (New England Biolabs #E0554S). The utilized mutagenic primers are as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... All disease variants were introduced using a Q5 site-directed mutagenesis kit (NEB, E0554S).
-
bioRxiv - Plant Biology 2022Quote: ... NEBNext DNA library components (New England Biolabs, Ipswich, MA) were used for fragmentation to 200-500 bp ...
-
bioRxiv - Neuroscience 2022Quote: ... that did not contain a reverse transcriptase component (NEB) served as no-reverse -transcriptase controls for DNA contamination ...
-
Machine learning-guided acyl-ACP reductase engineering for improved in vivo fatty alcohol productionbioRxiv - Synthetic Biology 2021Quote: ... or an in-house mixture of the components from NEB (T4 DNA ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Failsafe polymerase (Nordic Biolabs AB, Sweden) was used for efficient library amplification.
-
bioRxiv - Molecular Biology 2021Quote: ... Component A contained 1 μL of Bst 3.0 DNA polymerase (Cat. No. M0374L, NEB), 2.5 μL of 10 × isothermal amplification buffer ...
-
bioRxiv - Systems Biology 2020Quote: ... reaction components were added for second strand synthesis (70 μL water, 20 μL NEB second strand buffer ...
-
bioRxiv - Genetics 2021Quote: ... All components were combined using a Gibson assembly reaction (New England Biolabs ref # E2611L) following the manufacturer’s protocol and transformed into XL1 blue competent cells ...
-
bioRxiv - Systems Biology 2023Quote: ... All components were ligated together using NEB T4 Ligase (New England Biolabs, Ipswitch, MA) according to the manufacturers protocol ...
-
bioRxiv - Bioengineering 2020Quote: The following components comprised the RT-LAMP assay: 4 mM of MgSO4 (New England Biolabs), 1× final concentration of the isothermal amplification buffer (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2020Quote: Library amplification: Amplification was performed with components of the NEBNext Ultra II DNA kit (NEB E7645S) and a NEBNext Multiplex Oligos set (e.g ...
-
bioRxiv - Cell Biology 2019Quote: ... and detected using components based on the Phototope-Star detection kit (New England BioLabs, Cat# N7020). All T ...
-
bioRxiv - Genomics 2019Quote: ... then incubated with 16 µg of TET2 enzyme (EM-seq component E7130A, NEB, Ipswich MA, USA) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids for the trans-Tango components were generated using the Hi-Fi DNA Assembly (NEB #E5520S), BP Gateway Cloning (Thermo Fisher ...
-
bioRxiv - Cell Biology 2019Quote: ... 2013) with probes synthesized using components based on the NEBlot Phototope Kit (New England BioLabs, Cat# N7550) and detected using components based on the Phototope-Star detection kit (New England BioLabs ...
-
bioRxiv - Genomics 2019Quote: ... and deaminated with 100 U of APOBEC3A (EM-seq components E7133AA and E7134AA NEB, Ipswich, MA, USA) in 100 µl reaction volume for 3 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification of the library was performed with components of the NEBNext Ultra II DNA kit (NEB E7645S) and a NEBNext Multiplex Oligos set (e.g. ...
-
bioRxiv - Physiology 2022Quote: ... or OneTaq (New England Biolabs, BioNordika Sweden AB, Sweden), following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2019Quote: ... The pTATi1-TetO7Sag4 vector backbone was constructed from a four-component HiFi assembly (Cat# E5520, New England Biolabs): 1 ...
-
bioRxiv - Immunology 2020Quote: ... Linker insertion and modifications in the antigen-bearing components were achieved using Q5 Site Directed Mutagenesis Kit (NEB). Custom DNA primers produced by Integrated DNA technologies (IDT) ...
-
bioRxiv - Biochemistry 2021Quote: Each cyclization reaction contained the following components: 1 µL 10X T4 DNA ligase reaction buffer (New England BioLabs), 2 µL water ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μl of PNGase F (non-reducing, NEB) was added to remove protein N-glycosylations and the sample was incubated at 50°C for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: F(ab’)2 fragments were generated using IdeZ protease (NEB), purified using CaptureSelect LC-lambda affinity matrix (human ...
-
bioRxiv - Microbiology 2020Quote: ... RNA quantity was measured by Qubit (Nordic Biolabs AB, Sweden). RNA from stationary phase bacteria was collected after 8 hours of growth (OD600 ∼2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Second end processing and library amplification were performed with components of the NEBNext Ultra II DNA kit (NEB E7645S) and a NEBNext Multiplex Oligos set (e.g ...
-
bioRxiv - Synthetic Biology 2021Quote: ... carrying all remaining components in a Golden Gate reaction performed as described above but with Esp3I (10,000 U/mL, NEB) instead of BsaI ...
-
bioRxiv - Molecular Biology 2019Quote: ... The samples were then transferred on to the ice and the components (15 μl Blunt ligase master mix, 2.5 μl NEB Next adaptor for Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 pmol of TP_MAAAPQKCAAA* mRNA (see “Toeprinting assays” section) and components of the PURExpress ΔRibosomes Kit (New England Biolabs). The reaction was incubated at 37ºC for 20 min and then diluted in 50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... The AB fragments were digested with SalI-HF (New England Biolabs) and BglII (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... were ligated to end-repaired and A-tailed chromatin using components from NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) (25).
-
bioRxiv - Microbiology 2021Quote: ... The URA3 and 2μ components were amplified from pYES2 using primers (actatagcagcggaggggttggatcaaagtcttcctttttcaatgggtaataactga and caaccacagggttcccctcgggatcaaagtacaatcttcctgtttttggggc) using Phusion DNA polymerase (New England Biolabs) with annealing at 63°C and a 2 minute extension ...
-
bioRxiv - Genetics 2022Quote: ... We then combined SwaI digested BFA0190 and the components of each TFT reporter and used the NEB HiFi Assembly Kit (NEB) to produce each TFT plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... the V1-V3 region of 16S rRNA genes was amplified from 2 ng of DNA in 50 μl reactions containing the following components: 1x Standard Taq Reaction Buffer (NEB), 3 mM MgCl2 (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... put on ice for 5 min and the following components were added in the specified order: 1x capping buffer (NEB), 0.5 mM GTP ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were carried out in 10 μl of the purified components from the PURExpress In Vitro Protein Synthesis Kit (E6800S/L, NEB) with the corresponding templates ...
-
bioRxiv - Synthetic Biology 2021Quote: An aqueous mixture comprising all of the components for a RCA reaction was prepared to include: 1X Phi29 buffer (New England Biolabs), which has 50 mM Tris-HCl at pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... such that the final concentration of components in the 20 μl PCR were: 1X Q5 Reaction Buffer (New England Biolabs), 1X Q5 High GC Enhancer (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... Genes encoding individual components of biosensors were amplified by polymerase chain reaction (PCR) using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Site-directed mutagenesis was performed by QuikChange lightning mutagenesis kit (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... ptubg-[DCX orthologue]-mNeonGreenFP was generated with a three-component assembly using the NEBuilder HiFi Assembly kit (New England Biolabs, E2621S) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Vector components were purified using the Monarch® DNA Gel Extraction Kit or the Monarch® PCR & DNA Cleanup Kit (NEB) and assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... reaction was performed to remove sfGFP and replace it with the cassette components (P1-FLAG, P2-Substrate, P3-HA, P4-ERS). This plasmid was transformed into competent Escherichia coli (E. coli) (NEB#C2984H), purified (QIAGEN #27106 ...
-
bioRxiv - Genetics 2023Quote: ... with 0.04% non- acetylated bovine serum albumin (New England Biolabs). Cells were filtered through a 70µm filter and diluted to target 8,000 cells per run ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... For each extract non USER-treated and USER-treated (NEB) libraries were built 54 ...
-
bioRxiv - Microbiology 2021Quote: ... The components of the construct were joined using the Gibson Assembly method (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs, MA, USA), resulting in the dTomato gene under the control of several lengths of the promoter of lpmA (plasmids pRO311 ...
-
bioRxiv - Genetics 2020Quote: ... A length of 250 nt immediately preceding LdNT4 translation start was amplified from genomic DNA and both components were assembled via the Gibson Assembly method using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs, Ipswitch, MA).
-
bioRxiv - Synthetic Biology 2023Quote: ... The expression of each engineered component was validated pre- and post-sort by staining Jurkat cells with an anti-Myc antibody (#2233S, NEB, MA, USA), followed by performing flow cytometry on a FACSCanto (BD Biosciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... Using 10 μg of custom-made rabbit polyclonal anti-AcK142 Ab (Ez Biolabs), AcK142 PNKP was IP’d from 1 mg of GO-treated chromatin fraction from WT-PNKP-FLAG and K142R-PNKP-FLAG expressing cells ...
-
bioRxiv - Systems Biology 2020Quote: ... reaction components were added for second strand synthesis (70 μL water, 20 μL NEB second strand buffer, 10 μL NEB second strand enzyme). Second strand synthesis was carried out as described and the double-stranded cDNA was used as input for tagmentation ...
-
bioRxiv - Genomics 2019Quote: ... E7128A and E7131A diluted) followed by a 30 min incubation with 20 U of T4 BGT (EM-seq component E7129A, NEB, Ipswich, MA, USA) in the same buffer at 37°C ...