Labshake search
Citations for New England Biolabs :
1 - 50 of 2293 citations for Mouse DEFB15 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... a DNA fragment containing hU6 and shRNA was amplified from pLKO.1-shRNA using Phusion High-Fidelity DNA Polymerase (NEB) with primers that introduced SpeI restriction sites (Forward Primer ...
-
bioRxiv - Neuroscience 2023Quote: ... and Gas5 shRNAs (shRNA # 1= G5C1 and shRNA # 2= G5C2) were cloned by replacing the existing Luciferase shRNA (shRLuc) under a U6 promoter using BamHI (NEB #R0136L) and EcoRI (NEB #R3101 ...
-
bioRxiv - Microbiology 2019Quote: ... shRNA oligos were annealed in CutSmart buffer (New England Biolabs) by incubation of the sense and antisense strands at 94°C for 10 minutes and slow cooling to room temperature (RT) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cloning of the shRNA hairpin was performed using T4 ligase (NEB, M0202L) at a ratio of 3:1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding mouse Nav1.2 (NP_001092768.1) and Nav1.6 (NP_001070967.1) were cloned by Gibson Assembly (NEB) with synthetic gBlocks gene fragments (Integrated DNA Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse NIK coding sequence in the pENTR shuttle plasmid was mutated using Phusion high fidelity polymerase (NEB) and oligonucleotides designed to carry the desired mutations (indicated by lowercase letters) ...
-
bioRxiv - Molecular Biology 2022Quote: ... shRNAs were cloned into the pHIV7-Cerulean/puromycin transfer construct previously digested with NotI (NEB, R0189S) and NheI ...
-
bioRxiv - Cancer Biology 2020Quote: shRNA was cloned into pLKO.1 vector using restriction enzyme sites AgeI (NEB, Cat. No. R3552) and EcoRI (NEB ...
-
Efficient CRISPR/Cas9 genome editing in a salmonid fish cell line using a lentivirus delivery systembioRxiv - Genetics 2019Quote: ... the plasmids purified (NEB Monarch Plasmid miniprep) and sequenced to verify correct insertion using U6_Fw_seq primer (Table 1).
-
bioRxiv - Cancer Biology 2023Quote: ... Annealed shRNA oligos and digested TetON-pLKO constructs were mixed together with T4 DNA Ligase (NEB, M0202) and incubated for 3 hours at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... These included plasmid preparation (Monarch Plasmid Miniprep Kit, NEB), genomic DNA extraction from bacterial cells (DNEasy ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by plasmid isolation (NEB, Monarch Plasmid Miniprep Kit). The successful cloning was verified via Sanger sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids were purified (Monarch Plasmid Miniprep Kit, New England Biolabs), and sanger sequenced (Virginia Tech Genomics Sequencing Center) ...
-
bioRxiv - Microbiology 2024Quote: Plasmids DNA were extracted (Monarch Plasmid Miniprep, New England Biolabs) and sequenced by Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were isolated using Monarch Plasmid Miniprep kit from NEB and linearized using restriction enzyme by NEB as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µL of 100 µM sense and antisense shRNA oligos (synthesized by IDT) were then annealed and phosphorylated using T4 PNK (1µL 10X T4 Ligation Buffer (NEB), 6.5 µL H2O ...
-
bioRxiv - Biophysics 2020Quote: pUC19 plasmid (NEB) was relaxed from its supercoiled form by incubating with Topo I (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids were purified (Monarch Plasmid Miniprep Kit, New England Biolabs) and plasmid inserts were bidirectionally sequenced by an external contractor (Eurofins Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid was extracted using Monarch Plasmid Miniprep Kit (New England BioLabs) from the propagated E ...
-
bioRxiv - Cell Biology 2023Quote: pTO-GFP-SNX17 was used to generate an shRNA resistant version of GFP-SNX17 by introducing three silent mutations into the target sequence of the SNX17 shRNA clone 1 construct using the Q5-site directed mutagenesis kit (New England Biolabs). Specifically ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmid DNA was isolated using Monarch plasmid miniprep kit (NEB #T1010).
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were isolated from selected transformants using Monarch plasmid miniprep kit (NEB) and subjected to sequencing reactions (Eurofins ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting plasmids were purified using the Monarch Plasmid Miniprep Kit (NEB) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: The pBeloBAC11 plasmid (NEB) containing the entire viral genome of SARS-CoV-2 USA/WA1/2020 (WA-1 ...
-
bioRxiv - Microbiology 2020Quote: The pBeloBAC11 plasmid (NEB) containing the entire viral genome of SARS-CoV-2 has been previously described (19 ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... The PCR product was purified and then cloned into gRNA-expressing or shRNA-expressing vector using NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621). 100 ng product was then transformed into Endura ElectroCompetent cells according to the manufacturer’s directions ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmids were purified using the Monarch® plasmid miniprep kit (New England Biolabs) and sequenced to confirm the desired cloning result (Azenta/Genewiz) ...
-
bioRxiv - Biophysics 2023Quote: From the H6-RapA expression plasmid and pSNAP-tag(T7) plasmid (NEB #101137), we constructed a plasmid pKI1 (Addgene #199118 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid DNA extracted using the Monarch Plasmid Miniprep Kit (New England Biolabs), and Sanger sequencing used to confirm correct insertion of coding sequences at the Ramaciotti Centre for Genomics (UNSW Sydney) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmids were extracted using the Monarch Plasmid Miniprep Kit (New England Biolabs). Both pEndo and pTarget were transformed into E ...
-
bioRxiv - Developmental Biology 2023Quote: Plasmid DNA was purified using the Monarch Plasmid DNA Miniprep Kit (NEB, #T1010), and subjected to diagnostic restriction digest and subsequent gel electrophoresis ...
-
bioRxiv - Genetics 2021Quote: ... and the plasmid DNA was extracted using the Monarch® Plasmid Miniprep Kit (NEB). The presence of the correct inserts was done by performing a PCR reaction using the same primers as for the initial target amplification and using the corresponding plasmid DNA as a template.
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmids were isolated by using a Monarch Plasmid Miniprep kit (New England Biolabs) according to the manufacturer’s protocol and PCR amplified using primers MMEJ R1 and MMEJ R2R ...
-
bioRxiv - Microbiology 2022Quote: Plasmid DNA was prepared using a Monarch® Plasmid Miniprep Kit (NEB, cat# T1010). Genomic DNA was prepared using the DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated from individual colonies (Monarch Plasmid Miniprep Kit, New England Biolabs, #T1010L) and sequenced (Mix2Seq Kit NightXpress ...
-
bioRxiv - Bioengineering 2023Quote: ... and the plasmids were extracted via NEB Monarch Plasmid mini-prep kit (NEB T1010). Plasmid concentrations were measured spectrophotometrically at 260 nm via a Nanodrop 2000 (Thermo Scientific ...
-
bioRxiv - Pathology 2024Quote: ... 5 min ice) and plasmids were extracted using the Monarch Plasmid Miniprep kit (NEB) following manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: A pMAL-c2 plasmid (NEB) encoding N-terminally 6xHis tagged MBP-MS2 (Gift from Nadège Liaud ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were harvested from NEB Turbo chemically-competent E ...
-
bioRxiv - Neuroscience 2020Quote: Plasmids were amplified from NEB 5α bacterial cultures transformed with pCS2-cMyc-TBC1D3 (gratefully received from Zhen-Ge Luo’s team) ...
-
bioRxiv - Microbiology 2022Quote: ... within the pBeloBAC11 plasmid (NEB) containing the whole genomic sequence of SARS-CoV-2 WA-1 strain ...
-
bioRxiv - Biophysics 2021Quote: ... pBR322 plasmid (NEB, catalog #N3033S) was used as a vector for PCR amplification of 1116 bp long dsDNA using primers P1 and P2 (sequences of all primers are given in Table S1) ...
-
bioRxiv - Genetics 2023Quote: ... Circular plasmid (pUC19, NEB N3041S) and sheared (sonicated ...
-
bioRxiv - Synthetic Biology 2023Quote: Monarch Plasmid MiniPrep kit (NEB) for isolating template plasmid and assembled plasmid from E ...
-
bioRxiv - Biophysics 2024Quote: ... Plasmids were isolated from NEB Stable Competent cells using the QIAGEN Plasmid Plus Midi Kit.
-
bioRxiv - Genomics 2020Quote: ... As a control plasmid pCMV6 plasmid (4.6kb) was linearized by digestion with NdeI (NEB, RO111). 180 ng control linearized plasmid DNA and 180 ng of 3C library was treated with either 0.5 Unit exonuclease V (NEB ...
-
bioRxiv - Physiology 2019Quote: ... Plasmid DNA was isolated using a Monarch plasmid miniprep kit (New England Biolabs, Whitby, ON) and several clones were sent for sequencing for sequence validation ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by plasmid DNA isolation using the Monarch® Plasmid Minprep kit (New England Biolabs) or a NucleoBond® Xtra Midi kit (Machery-Nagel) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids from clones were purified using a Monarch plasmid miniprep kit (New England Biolabs, USA) and subjected to whole plasmid sequencing (SNPsaurus ...