Labshake search
Citations for New England Biolabs :
1 - 50 of 1589 citations for Mouse Anti Staphylococcus Aureus Enterotoxin I Antibody SEI 68 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Each plug was melted in 200 µl TE at 68 °C for 30 minutes and then digested using β-agarase I (BioLabs, M0392L) at 42 °C overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Microbiology 2019Quote: ... aureus ATCC 25923 using Q5 Hot Start High-Fidelity DNA Polymerase (NEB) and the primers listed on Table S3 ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Maltose Binding Protein monoclonal antibody IgG2a (New England Biolabs), mouse anti-Histone H3 [Trimethyl Lys9] 6F12-H4 (Novus Biologicals) ...
-
bioRxiv - Microbiology 2019Quote: ... aureus genome were PCR amplified (Q5 Hot Start High-Fidelity DNA Polymerase (NEB)) with the primers summarised in Table S3 ...
-
bioRxiv - Microbiology 2023Quote: ... aureus strains were performed using Monarch® Total RNA Miniprep Kit (NEB, UK) and SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Molecular Biology 2020Quote: ... antibody were incubated with 25 µL of magnetic anti-mouse beads (NEB) overnight ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-insulin was from Sigma (I-2018) and anti-SNAP from NEB (P9310S). The coverslips were mounted on glass slides with VectaShield Antifade Mounting Medium and fixed with nail polish ...
-
bioRxiv - Microbiology 2020Quote: ... aureus Sle1 (SAOUHSC_00427) was cloned into the NdeI and BamHI sites of pMAL-c5X (New England Biolabs) with primers oTD22 and oTD23 and transformed into E ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Cell Biology 2019Quote: ... then incubated with either mouse anti-MBP antibodies at a dilution of 1:5000 (New England Biolabs) or 1:2500 mouse anti-GFP antibodies (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Microbiology 2020Quote: ... were digested with BamH I and Xho I (NEB) (Thermo Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... at 68°C for 20 min and transferred to 42°C where 1.5 μL of ß-agarase (New England Biolabs) was added and incubated overnight ...
-
bioRxiv - Cell Biology 2021Quote: One plug per sample was melted at 68°C in 1 mL 100 mM MES buffer pH 6.5 prior to addition of β-agarase (New England Biolabs) and incubation overnight at 42°C ...
-
bioRxiv - Microbiology 2022Quote: ... DNAse I (NEB) treated samples were cleaned up using RNAeasy cleanup kit (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... DNAase I (NEB) was then added to reactions to eliminate all remaining extracellular DNA ...
-
bioRxiv - Microbiology 2020Quote: ... DNase I (NEB) treatment was performed on at least 5 µg RNA for 10 minutes at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... DNAse I (NEB), RNAse H (NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... DNAse I (NEB), RNAse H (NEB)) ...
-
bioRxiv - Genetics 2023Quote: ... Exonuclease I (NEB) and Plasmid-Safe ATP-dependent DNase (Lucigen ...
-
bioRxiv - Neuroscience 2023Quote: ... DNase I (NEB), and murine RNase inhibitor (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... RNase I (NEB) and DNase I (NEB ...
-
bioRxiv - Genomics 2024Quote: ... Exonuclease I (NEB), Plasmid-Safe ATP-dependent DNase (Lucigen ...
-
bioRxiv - Microbiology 2024Quote: ... DNase I (NEB) were added into the sample to remove possible extracellular DNA fibers.
-
bioRxiv - Microbiology 2024Quote: ... DNase I (NEB) were added into the sample to remove possible extracellular DNA fibers.
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Plant Biology 2022Quote: ... The samples were pooled by row into 8-strip tubes and excess primers were digested with the addition of 4.6 µL exonuclease I mix (2.5 µL of 10X Exonuclease I Buffer, 2.1 µL Exonuclease I; New England Biolabs) then incubated at 37□ for 20 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exonuclease I reaction mixture (1X Exo-I buffer, 1 U/µL Exo-I (New England Biolabs, cat# M0293L)) was pipetted into the device followed by an incubation at 37 °C for 45 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exonuclease I reaction mixture (1X Exo-I buffer, 1 U/µL Exo-I (New England Biolabs, cat# M0293L)) was pipetted into the device followed by an incubation at 37 °C for 45 min ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... pUAS vector was digested using Not I and Kpn I (NEB).
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1) using the Q5 site-directed mutagenesis kit from New England Biolabs (NEB, USA). HA-GLUT4 and HA-GLUT1 were extracted using AcsI and EcoRI restriction enzymes and Cutsmart buffer from NEB and the agarose gel extraction kit from Qiagen ...
-
bioRxiv - Developmental Biology 2019Quote: Reporter gene fusions for cis-regulatory analysis of terminal identity genes were made using either PCR fusion [68] or Gibson Assembly Cloning Kit (NEB #5510S). Targeted DNA fragments were fused (ligated ...
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... which was digested with Not I and Xho I restriction enzymes (NEB), using Gibson Assembly (NEbuilder ...
-
bioRxiv - Genomics 2021Quote: ... a DNase-I digest was performed by using 1U DNase-I (NEB) in a total volume of 100 µl ...
-
bioRxiv - Cell Biology 2019Quote: ... pAc 5.1 vector was digested by EcoR I and Not I (NEB). The amplified CTPS ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μL DNA Pol I and 20 U DNase I (NEB, U.K.), 1 mM each of dATP ...