Labshake search
Citations for New England Biolabs :
1 - 50 of 2134 citations for Lysophosphatidic Acid Receptor 5 LPAR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs). All DNA was sequence verified using Sanger nucleotide sequencing (Retrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were resolved on an 12% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membrane for detection with the following antibodies: anti-Glucocorticoid Receptor D6H2L (1:1000 dilution, Cell Signaling, New England BioLabs #12041), anti-PAX7c (1:500 dilution ...
-
bioRxiv - Systems Biology 2019Quote: ... immunoprecipitated receptors were deglycosylated with PNGase F (New England Biolabs), before resuspending in LDS sample buffer and running on NuPAGE 4-12% Bis Tris precast gels ...
-
bioRxiv - Microbiology 2021Quote: ... or 5 µl anti-H3K18cr antibody (PTM-517, PTM Biolabs) together with protein A agarose (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... and tumbled with 5 μg of anti-m6A antibody (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Neuroscience 2022Quote: ... Receptor cDNAs were amplified by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs) from cDNA of mixed-stage populations of wild-type C ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Cell Biology 2021Quote: ... Receptors were surface labelled by addition of Snap-Cell 647 SiR (1:1000, New England Biolabs) to the media for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Mutations were generated in the rat P2X2 receptor using the Q5 Site-Directed Mutagenesis Kit (NEB). Each mutation was verified by DNA sequencing and subcloned in pWPT-EF1α-P2X2-GCaMP6s-IRES-DsRed2 or pWPT-EF1α-P2X2-GCaMP6s-P2A-mScarlet lentiviral vectors.
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of Snap-Cell 647 SiR (1:1000, New England Biolabs) to the media for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Receptors were surface labeled by addition of SNAP-Surface Alexa Fluor 546 (1:1000, New England Biolabs) to DMEM F12 without serum and phenol red (21041-025 ...
-
bioRxiv - Biochemistry 2023Quote: ... formic acid was purchased from Biolabs ltd ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids encoding chimeric SCS6/MLA1 and SCS6/MLA6 receptors were assembled using the NEBuilder HiFi assembly Kit (NEB) based on the domain boundaries reported in (28) ...
-
bioRxiv - Biochemistry 2023Quote: Amino acid sequencing and glycan localization were carried out by digesting the antibody samples with trypsin or chymotrypsin (New England Biolabs, Ipswich, MA) followed by LC-MS/MS analysis of proteolytic fragments with an Orbitrap Fusion (Thermo ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The resulting library was pooled into 12 separate 60 amino acid long sub-libraries (amino acids 1-60, 61-120 etc.) and combined via Gibson Assembly (NEB) with a linearized p414ADHΔter Hsp90 destination vector ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg antibody (Table. S3) and 50 µl protein A magnetic beads (New England Biolabs, Cat. No. S1425S) were added to the supernatant and incubate overnight at 4 degree Celsius ...
-
bioRxiv - Biochemistry 2020Quote: ... and m7G(5′)ppp(5′)A (NEB, #S1405S) also referred throughout the manuscript as N7-meGpppG and N7-meGpppA for consistency ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL RNase H (5 U/µL, NEB), 2.5 µL RNase III (1 U/µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Cell Biology 2023Quote: ... gel extracted using Monarch Nucleic Acid Purification Kits (NEB) and submitted for Sanger Sequencing ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 µl Taq 5× Master Mix (New England Biolabs) and 18 µl Milli-Q water (18.2 MΩ cm) ...
-
bioRxiv - Developmental Biology 2023Quote: ... then capped with m7G(5’)ppp(5’)G (NEB) and tailed with a poly(A ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl T4 PNK (NEB M0201, 5 U/μl), and incubated for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)G RNA (GpppG) (NEB, # S1407S) are from New England Biolabs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’-cap was removed using RNA 5′ pyrophosphohydrolase (Rpph, NEB) followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Plant Biology 2022Quote: Nucleic acids were digested using the Nucleoside Digestion Mix (NEB) with the following modifications ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the Monarch Nucleic Acid Purification Kits (T1020 and T1030, NEB) were used ...
-
bioRxiv - Immunology 2022Quote: ... The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7). In brief ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...