Labshake search
Citations for New England Biolabs :
1 - 50 of 930 citations for Japanese Encephalitis Virus Envelope Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The time between nuclear envelope breakdown (NEB) and anaphase onset (AO ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells undergoing mitosis were tracked from nuclear envelope breakdown (NEB) to anaphase onset ...
-
bioRxiv - Cell Biology 2020Quote: ... Mitotic duration was defined as the time from nuclear envelope breakdown (NEB) until division ...
-
bioRxiv - Cell Biology 2019Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB), which could be determined in our movies by adjusting the contrast to visualise when the cytoplasmic pool of the fluorescent protein was first observed to enter into the nucleus.
-
bioRxiv - Cell Biology 2022Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... The time taken for each cell to progress from nuclear envelope breakdown (NEB) to anaphase onset (chromatid separation ...
-
bioRxiv - Immunology 2022Quote: HIV envelope plasmids were transformed and amplified in NEB-stable competent cells (NEB, C3040H). Pseudoviruses were produced by co-transfection of plasmids encoding various HIV-1 Envs together with NL4-3 ΔEnv or Q23-ΔEnv (1:3 ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Vaccinia virus Capping enzyme (NEB) and biotinylated RNA species were subsequently enriched by affinity purification using streptavidin beads yielding 0.6 to 1.3% of the sRNA preparation ...
-
bioRxiv - Developmental Biology 2024Quote: ... Once PCNA foci disappear the G2 phase starts and lasts until nuclear envelope breakdown (NEB). After apical mitosis ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercially available vaccinia virus capping system (NEB #M2080S) was used as a positive control.
-
bioRxiv - Biochemistry 2019Quote: ... 37°C with vaccinia virus capping enzyme (New England Biolabs), as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and Moloney murine leukemia virus reverse transcriptase (New England Biolabs). Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... only centriolar pairs that could be tracked from the beginning of nuclear cycle 12 until nuclear envelope breakdown (NEB) (for Sas-6)/beginning of nuclear cycle 13 (for Ana2)/throughout the entire detection window of the oscillation (for Plk4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Envelope gene mutations were introduced into WT cDNA sequence using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All cloned were sequenced (Eurofins).
-
bioRxiv - Zoology 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Evry, France) and random hexamer primers were used to transcribe 1 μg RNA in a 20 μl reaction into cDNA.
-
bioRxiv - Developmental Biology 2021Quote: ... All oligos were radioactively capped using Vaccinia virus capping system (NEB) and [α-32P]-GTP (Perkin-Elmer) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...
-
bioRxiv - Molecular Biology 2021Quote: All eight gene segments of the isolated H6N1 virus were amplified (NEB), purified (Omega ...
-
bioRxiv - Microbiology 2021Quote: ... Virus stocks were recovered following linearization of infectious clone plasmids using NotI-HF (NEB), in vitro transcription ...
-
bioRxiv - Microbiology 2022Quote: ... The virus lysate was then denatured by boiling in denaturing buffer (New England BioLabs) for 10 min and treated with PNGase F or Endo Hf enzymes (New England BioLabs ...
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Virus stocks were generated by either transfecting purified in vitro transcribed viral RNA (HiScribe, NEB) or transfecting the infectious cDNA clone containing plasmid in BHK-T7 cells ...
-
bioRxiv - Biochemistry 2023Quote: Infection in HCT116: Cells were infected with virus and 8 μg/mL polybrene (NEB, #H9268).
-
bioRxiv - Cell Biology 2024Quote: ... RNA was reverse transcribed with Moloney murine leukemia virus (M-MuLV) transcriptase (New England Biolabs). The purity and concentration of RNA were measured using NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... cell and virus particle lysates were treated with PNGase F and Endo Hf (New England Biolabs) following the manufacturer’s protocol for 1 hour at 37°C prior to Western blotting.
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Microbiology 2021Quote: ... in the 5’end of 30 mer RNA substrate we used the vaccinia virus capping enzyme following the manufacturer’s protocol (New England Biolabs), except that the methyl donor SAM was absent and 0.05 units of inorganic pyrophosphatase (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2 -O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Microbiology 2024Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2L-O-methyltransferase (New England Biolabs). The mRNA was purified ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids encoding HA-tagged LC3B proteins were generated by replacing the EGFP sequence in the EGFP plasmids with an HA-tag followed by a Tobacco etch virus protease sequence recognition site and a Flag-Tag (Genewiz) using AgeI and HindIII (New England Biolabs). Lipidation-deficient LC3B proteins were generated by mutagenic PCR using Q5 Hot Start High-Fidelity Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized from 500 ng of total RNA with retrotranscriptase from Moloney murine leukemia virus (Ref. M0253, New England BioLabs) and random hexanucleotides as primers by following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE, NEB) in the presence of GTP and S-adenosylmethionine (SAM) ...
-
bioRxiv - Biochemistry 2020Quote: ... a maltose binding protein (MBP) and a Tobacco Etch Virus (TEV) protease cleavage site in the N-terminal via Gibson assembly (New England Biolabs) as per the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2020Quote: ... mutations were inserted into the open reading frame of Vesicular stomatitis virus glycoprotein VSV-G using the Q5 SDM kit (NEB). Myc epitope-tagged SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA depleted RNA was used as the template for reverse transcription performed with Moloney murine leukemia virus (MMLV) reverse transcriptase (M0253, NEB). The cDNA samples were then diluted 1:4 in water and used in quantitative real-time PCR with genespecific primers using SsoAdvanced Universal Sybr green Supermix (1725271 ...
-
bioRxiv - Microbiology 2021Quote: ... Virus titer was determined using SYBR-based one step qRT-PCR with Luna Universal One Step qRT-PCR reagent (NEB). QuantStudio 5 (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA depleted RNA was used as the template for reverse transcription performed with Moloney murine leukemia virus (MMLV) reverse transcriptase (M0253, NEB). The cDNA samples were then diluted 1:4 in water and used in quantitative real-time PCR with gene-specific primers using SsoAdvanced Universal Sybr green Supermix (1725271 ...
-
bioRxiv - Developmental Biology 2022Quote: ... using 200-300 ng of purified RNA as template and Moloney Murine Leukemia Virus (M-MuLV) Reverse Transcriptase (M0253, NEB). cDNA was synthesised using the standard first strand synthesis protocol with random hexamers (S1230 ...
-
bioRxiv - Plant Biology 2022Quote: All ObANS genes were inserted into the pBI121 plasmid under the control of the constitutive Cauliflower mosaic virus 35S promoter using the SacI and XbaI restriction enzymes (Thermo-scientific) and the NEBuilder ligation system (NEB). The plasmids were transformed into Agrobacterium tumefaciens strain GV3101 using electrotransformation and positive colonies were selected with kanamycin ...
-
bioRxiv - Molecular Biology 2023Quote: ... A CRISPR array containing two repeats and one spacer targeting the gfp gene of recombinant Sindbis virus (SINV-GFP) was generated by annealing and extending two partially complementary DNA oligos with Q5 polymerase (NEB) (Table S1) ...
-
bioRxiv - Physiology 2023Quote: ... was obtained by reverse transcription (RT) using 1 μg of RNA and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (M0253, NEB), using the first strand cDNA synthesis standard protocol with random primers (S1330 ...
-
bioRxiv - Microbiology 2024Quote: The ectodomains of the hemagglutinin proteins from selected influenza virus strains were ordered as synthetic DNA fragments from Twist Biosciences and cloned with a barcoded fragment encoding the last 46 amino acids of WSN HA as 3-segment assembly reaction into a construct containing the 3’ non-coding region of the packaging signal and signal peptide from A/WSN/1933 influenza HA and the a Read 1 Illumina sequence and the full 5’ packaging signal from A/WSN/1933 virus using Hifi Assembly Mastermix (NEB). The backbone for this cloning reaction was a pHH21 plasmid (16 ...
-
bioRxiv - Biochemistry 2023Quote: ... modified to include a tobacco etch virus (TEV) protease recognition sequence downstream of the 6xHis-tag47 using NEBuilder HiFi DNA assembly master mix (New England BioLabs). Sequences were verified by Sanger DNA sequencing [Genomics Shared Resource ...