Labshake search
Citations for New England Biolabs :
1 - 50 of 138 citations for IL 21 Mouse 129a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... coli BL-21 (DE3) (New England Biolabs) cells and 5mL starter cultures were grown overnight at 37C in Lysogeny Broth (LB ...
-
bioRxiv - Biochemistry 2024Quote: ... coli BL-21 cells (New England Biolabs) were used for the transformation of pET-28b(+ ...
-
bioRxiv - Microbiology 2021Quote: ... streptavidin magnetic beads (21 μL per reaction; NEB) were washed once in an equal volume of 1X SSC and then resuspended in 7.5 μL per reaction 1X SSC with 1 μL per reaction of Superase-In (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... coli C2527 (BL-21) (New England Biolabs, Inc) for purification ...
-
bioRxiv - Cell Biology 2020Quote: ... a 21 kb genomic DNA fragment of bacteriophage lambda (NEB) was flanked by a unique XbaI (position 0 ...
-
bioRxiv - Biophysics 2021Quote: MukF Flag-tagged fragments were expressed from pET 21 plasmids in C3013I cells (NEB).The Flag-tagged MukE and MuF were at the C-terminus ...
-
bioRxiv - Biochemistry 2019Quote: Activating adaptors containing amino-terminal HaloTags were expressed in BL-21[DE3] cells (New England Biolabs) at OD 0.4-0.6 with 0.1 mM IPTG for 16 hr at 18°C ...
-
bioRxiv - Cell Biology 2021Quote: Activating adaptors containing amino-terminal HaloTags were expressed in BL-21[DE3] cells (New England Biolabs) at OD 0.4-0.6 with 0.1 mM IPTG for 16 hr at 18°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... and succinyl-lysine (PTM Biolabs, Chicago, IL, USA) were used to capture SIRT1-SIRT7 proteins overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... pET17b-Kif5b(1-560)-GFP-His was transformed into BL-21[DE3]RIPL cells (New England Biolabs) until an optical density at 600 nm of 0.6-0.8 and expression was induced with 0.5 mM isopropyl-β-d-thiogalactoside (IPTG ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and chromatin was digested for 7.5 minutes at 21°C using micrococcal nuclease (MNase) (New England Biolabs). We spiked DNA from D ...
-
bioRxiv - Biochemistry 2023Quote: BicD2 and NINL containing amino-terminal HaloTags were expressed in BL-21[DE3] cells (New England Biolabs) at an optical density at 600 nm of 0.4–0.6 with 0.1mM IPTG for 16h at 18°C ...
-
bioRxiv - Genomics 2023Quote: ... L1 - Adaptor.L8 with Adaptor.S (21)) was annealed with the DNA fragments by T4 DNA ligase (New England Biolabs) incubating overnight at 16 °C ...
-
bioRxiv - Microbiology 2023Quote: NINL (1-702) containing an amino-terminal HaloTag was expressed in BL-21[DE3] cells (New England Biolabs), which were then grown until OD 0.4-0.6 and induced with 0.1 mM IPTG for 16 hr at 16°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... A-tailed fragments were ligated to 50 nL of 5 mM T7 promoter containing adapters(21) with cell barcodes and UMI with 150 nL ligation mix (25 nL T4 DNA ligase (400.000U, NEB), 3.5 nL MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... which was subsequently cloned into linearized pUHE-21 (106) using NEBuilder HiFi DNA Assembly Cloning Kit (New England BioLabs). Construct was verified by Sanger DNA sequencing with primers 146 and 156.
-
bioRxiv - Synthetic Biology 2023Quote: ... The lipid film was rehydrated by vortexing with 21 μL rehydration solution (14 μL PURExpress Solution A, 0.875 μL RNase Inhibitor (NEB), 17 μM IGEPAL (90mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... The gene fusion was then amplified using primers 20 and 21 and cloned into pClimDC linearized at the SalI restriction site using Gibson Assembly (New England Biolabs). To build pClimDC-Lifeact:mCh ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid hcm1 sequence was amplified by PCR for 21 cycles with vector specific primers using Phusion High-Fidelity DNA polymerase (New England Biolabs). Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: A second-generation lentiviral transfer plasmid encoding expression of EF1ɑ promoter - CAR-P2A-mCherry (21) was digested with XbaI & MluI (New England Biolabs) to drop out the CAR-P2A-mCherry transgene ...
-
bioRxiv - Cell Biology 2023Quote: ... and 21-base pair (bp) barcodes (post-culture) were amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Primers used are listed in Supplemental Table 11 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragments containing 21 base pair overhangs homologous to the vector backbone were generated by PCR using Phusion High-Fidelity DNA polymerase (NEB, M0530), purified ...
-
bioRxiv - Neuroscience 2020Quote: ... with PAM underlined: GCAACTGGTACAGATGACACAGG) targeting exon 21 of the Brp gene was generated using the HiScribe T7 Kit (New England Biolabs #E2040S) by incubating for 6 hours at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... or 300 ng (day 21) of total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs E7490L). Libraries were prepared using the NEBNext Ultra II RNA Library Prep kit with Sample Purification Beads (E7775S ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of total RNA were ligated to the pre-annealed custom RT adaptors (21) using concentrated T4 DNA Ligase (NEB-M0202T). Ligated RNA was reverse transcribed using Maxima H Minus RT (Thermo Scientific ...
-
bioRxiv - Bioengineering 2024Quote: cDNA of each library was generated using oAS345 (Supplemtary Note 21) and LunaScript Primer-Free RT Master Mix Kit (NEB E3025S).
-
bioRxiv - Molecular Biology 2021Quote: ... pH 8.0) were incubated with pre-washed pan anti-Kbhb beads (PTM Biolabs Inc., Chicago, IL) at 4 °C overnight with gentle shaking ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse α-MBP (NEB, 1:10000); mouse α-Pol II CTD clone 8WG16 (Abcam ...
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... MBP (mouse, 1:30,000, New England Biolabs), FLAG (mouse ...
-
bioRxiv - Cell Biology 2019Quote: ... by random priming without denaturation with 4 mg random nonamer oligo (Integrated DNA Technologies, Skoie IL) and 10 units of Klenow (New England Biolabs, Ipswich, MA). Unincorporated dye was removed with Microcon columns (30 kDa MW cutoff ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoprecipitation experiments were performed with 15 μL of Pan anti-glycine lysine antibody conjugated to agarose beads (PTM Biolabs, Chicago, IL, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-PPARα (1:25, Arigo Biolabs ARG55240). Alexa Fluor conjugated secondary antibodies (ThermoFisher Scientific ...
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... anti-MBP mouse 1/80,000 (E8032S, New England Biolabs). Western Blots were quantified using Fiji ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-myc (NEB/Cell Signaling, 2276; 1:1500) o/n at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti Pan-Keratin (clone C11, NEB, 4545S). Primary antibodies were incubated with sections overnight at 4°C except for anti-CD3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were stained with mouse anti-MBP (NEB, 1:500), followed by washing and subsequent incubation with goat anti-mouse IgG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were stained with mouse anti-MBP (NEB, 1:500), followed by washing and subsequent incubation with goat anti-mouse IgG ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse α-myc (New England Biolabs, clone 9B11, 1:2,000), rabbit α-pol-I largest subunit 15 (1:100 ...
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Genetics 2024Quote: ... and mid-range PFG ladder (for mouse samples) (NEB Inc.) and 1 kb ladder (GeneDirex Inc.) ...