Labshake search
Citations for New England Biolabs :
1 - 50 of 363 citations for IL 15 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Immunoprecipitation experiments were performed with 15 μL of Pan anti-glycine lysine antibody conjugated to agarose beads (PTM Biolabs, Chicago, IL, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Cancer Biology 2021Quote: ... and succinyl-lysine (PTM Biolabs, Chicago, IL, USA) were used to capture SIRT1-SIRT7 proteins overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15□l of 2.1 buffer (NEB), 30 units of SSP1 (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... and 15 units of Quick CIP (NEB) by incubating at 37°C for 20 min followed by Quick CIP inactivation at 80°C for 3 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 15 units of Exonuclease V (RecBCD; NEB) and T5 exonuclease (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 15 units of T4 DNA polymerase (NEB) and 5 units of Klenow DNA polymerase (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by a 15 min DNaseI (NEB) digestion at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... followed by 15 min DNAse I (NEB) treatment at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 15 μL T4 ligase (NEB, cat#M0202S), 30 μL T4 ligase buffer and ...
-
bioRxiv - Genomics 2023Quote: ... Ligated junctions were pulled-down with Dynabeads® MyOne™ Streptavidin C1 beads for 15 min at RT and DNA ends were A-tailed with 15 Units of Klenow exo- (cat. M0212L, NEB). Barcoded PerkinElmer adapters (cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Ligated junctions were pulled-down with Dynabeads® MyOne™ Streptavidin C1 beads for 15 min at RT and DNA ends were A-tailed with 15 Units of Klenow exo- (cat. M0212L, NEB). Barcoded PerkinElmer adapters (cat ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 15 units of T4 PNK enzyme (NEB). The reaction was incubated at 37 °C for two hours and PAGE–purified.
-
bioRxiv - Bioengineering 2020Quote: ... and 15 uL of H2O) (New England Biolabs) for 1 hour at 37°C followed by DNase I (10 µL DNase I ...
-
bioRxiv - Genomics 2023Quote: ... 15 μL 2x Q5U Master Mix (NEB M0597S), 0.4 μL 100 μM Nextera P5 index primer and 0.4 μL 100 μM Nextera P7 index primer ...
-
bioRxiv - Genomics 2024Quote: ... and 15 U Klenow exo (New England Biolabs), for 30 min at 37°C before inactivation for 20 min at 65°C ...
-
bioRxiv - Genomics 2024Quote: ... 15 U T4 polynucleotide kinase (New England Biolabs), 5 U Klenow DNA polymerase (Roche) ...
-
bioRxiv - Genomics 2021Quote: ... and 15 units of Phi29 polymerase (New England Biolabs). We used a PCR machine (SimpliAmp ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 U T4 RNA Ligase High Concentration (M0437, NEB)) were added as well as 10 μl 50% PEG8000 and reaction was mixed by pipetting up- and down until beads are resuspended ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 15 units of Klenow (3′→5 ′ exo–) polymerase (NEB) with 66 nM dNTPs for 30 minutes at 30°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 15-20 µL of amylose beads (New England Biolabs) were mixed with (MBP)2-WRC (bait ...
-
bioRxiv - Genomics 2023Quote: ... 15 units of RNase H1 (NEB, cat. no. #M0297) or 1 μg/μL RNase A (Life Technologies ...
-
bioRxiv - Genomics 2023Quote: ... and 15 units of Phi29 polymerase (New England Biolabs). We used a PCR machine (SimpliAmp ...
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 15 units of Klenow Fragment (3’→5’ exo-, NEB). Following extension reactions ...
-
bioRxiv - Genomics 2021Quote: ... 15 μL of MboI restriction enzyme (New England Biolabs R0147) was used for digesting chromatin from 15 million MEFs ...
-
bioRxiv - Biochemistry 2022Quote: ... Then complexes were bound to 15 µl amylose agarose (NEB) by rotating the tube at 4 °C for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Microbiology 2019Quote: ... falciparum and human histones (New England Biolabs) (6µg) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 U RNase Inhibitor Human Placenta (NEB), 50 pmol Oligo d(T)23 (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Human CK2 was obtained from NEB (P6010S). IE2-NTD was phosphorylated in buffer provided by the manufacturer which contains 50mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation reactions were conducted using 15 pmol of RtcB (NEB), 1x RtcB buffer (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... 0.025 mM dGTP and 15 U T4 DNA polymerase (NEB # M0203L). The samples were brought up to 50 µL total volume adding ultrapure distilled water ...
-
bioRxiv - Cell Biology 2022Quote: ... and amplified for 15 PCR cycles using Q5 polymerase (NEB, M0491). PCR products were run on a gel ...
-
bioRxiv - Biophysics 2019Quote: ... for 15 minutes at 12°C in 1x buffer 2.1 (NEB), to remove 3’-A overhangs.
-
bioRxiv - Molecular Biology 2023Quote: ... Viral cDNA was amplified for 15 cycles with Phusion polymerase (NEB) using a primer complementary to the adaptor (TGGATTGATATGTAATACGACTCACTATAGG ...
-
bioRxiv - Cell Biology 2023Quote: ... Klenow fragment (5 U) & T4 polynucleotide kinase (15 U) (NEB; M0201). The A-tailing was performed with Klenow exo-fragment (15 U ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µg of pUPRT plasmid was linearised with AgeI-HF (NEB) (GRA59 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1mM DTT) before adding 15 µl 1 mg/ml Streptavidin (NEB) before immediate wash with DLB-C-T buffer (DLB supplemented with 1 mg/ml α-casein ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Human HA-DHFR was subcloned from human cDNA to pcDNA4/TO by PCR using Q5 High Fidelity 2X mastermix (NEB). Human FPGS-FLAG and GGH-FLAG were subcloned from cDNA clones MHS6278-202755815 (Horizon Discovery ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Biophysics 2020Quote: ... from human origin were all purchased from NEB. The H2A/H2B and H3.1/H4 were mixed in 2(H2A/H2B)2:1(H3/H4)4 molar ratio to form octamers.
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human histone H4 (New England Biolabs # M2504S) was used as a substrate ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation reactions were conducted using 15 pmol of RtcB ligase (NEB), 1x RtcB buffer (NEB) ...
-
bioRxiv - Bioengineering 2021Quote: Escherichia coli strains DH5α [15] and ER2523 (New England Biolabs, Ltd., UK) were grown in Luria Bertani (LB ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 μg protein was mixed with 15 μL Glycoprotein Denaturing Buffer (NEB) in 150 μL total volume and incubated at room temperature for 10 min ...