Labshake search
Citations for New England Biolabs :
1 - 50 of 1594 citations for IL 10 Rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Microbiology 2021Quote: ... and rat (New England Biolabs), following the manufactures instructions.
-
bioRxiv - Cell Biology 2019Quote: ... by random priming without denaturation with 4 mg random nonamer oligo (Integrated DNA Technologies, Skoie IL) and 10 units of Klenow (New England Biolabs, Ipswich, MA). Unincorporated dye was removed with Microcon columns (30 kDa MW cutoff ...
-
bioRxiv - Microbiology 2021Quote: ... and rat (New England Biolabs, USA) that specifically depletes cytoplasmic (5S ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Cancer Biology 2021Quote: ... and succinyl-lysine (PTM Biolabs, Chicago, IL, USA) were used to capture SIRT1-SIRT7 proteins overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... and on the Sprague Dawley (SD) strain (rats) (Hera Biolabs) were obtained from vendor and breed in the Division of Laboratory Animal Resources (DLAR ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid DNA encoding rat HEV was linearized using EcoRI (NEB). Five percent of the reaction was subjected to gel electrophoresis with ethidium bromide staining and visualized with ultraviolet light to verify that linearization had occurred.
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL 10% NP-40 (NEB), 10 μL PNGase F (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... The entire rat Cx43 sequence was removed using EcoRI (Cat. No. R3101S; NEB) and BamHI (Cat ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... and AAV9-based rep-cap plasmids incorporating individual heptameric peptides (EC1-10) (pACG2-[EC1-10], pACG2-QuadYF+TV-[EC1-10], and pACG9-[EC1-10]) were generated through site-directed mutagenesis (NEB Q5 site-directed mutagenesis kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... pH 8.0) were incubated with pre-washed pan anti-Kbhb beads (PTM Biolabs Inc., Chicago, IL) at 4 °C overnight with gentle shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Clean RNA was first rRNA depleted using the NEBNext rRNA depletion kit (Human/Mouse/Rat) (NEB) before being prepared for sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) according to the manufacturer’s instructions with 6 µl total RNA used as input per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... Mutations were generated in the rat P2X2 receptor using the Q5 Site-Directed Mutagenesis Kit (NEB). Each mutation was verified by DNA sequencing and subcloned in pWPT-EF1α-P2X2-GCaMP6s-IRES-DsRed2 or pWPT-EF1α-P2X2-GCaMP6s-P2A-mScarlet lentiviral vectors.
-
bioRxiv - Genomics 2019Quote: ... followed by adding 10 µL PNK (10 U/µL, NEB). The mixture was incubated for 30 min at 37 °C with shaking at 800 rpm ...
-
bioRxiv - Genetics 2024Quote: ... 10 µL 10 mg/mL BSA (NEB cat no. B9000s), 840 μL DNA grade H2O (Invitrogen Waltham ...
-
bioRxiv - Genomics 2021Quote: 10 μg genomic DNA from transfected mESCs were digested using 10 μl 10 U/μL NlaIII (NEB, #R0125S) in a 50 μL final volume for 3 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... in 50 μl of total reaction volume (10 μl 5X KAPA buffer, 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 50 μl of total reaction volume (10 μl 5X KAPA buffer, 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 50 μl of total reaction volume (10 μl 5X KAPA buffer, 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM MgCl2) and 10 U Klenow (exo-) polymerase (NEB, M0212S) and α-32P-dCTP (Perkin Elmer ...
-
bioRxiv - Molecular Biology 2022Quote: ... We then carried out rRNA depletion with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat NEB # E6310S) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and libraries were prepared using the NEBNext rRNA Depletion Kit for Human/Mouse/Rat (NEB Cat#E6310). Adapter-ligated cDNA was amplified with 11 cycles of PCR to generate libraries ∼300 bp in length ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA/sgRNA/Cas9 ratios of 1/10/10 were used in a 10 µl reaction using the buffer supplied (NEB) and DEPC-treated water (Haussmann et al ...
-
bioRxiv - Genomics 2019Quote: ... DNA was digested by adding 10 µL NlaIII (10 U/µL, NEB) and incubated for 3½ h at 37 °C with shaking at 1200 rpm ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ligation reaction (10 μL) consisted of 10 units of BbsI (NEB), 600 units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...