Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Human H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Genetics 2020Quote: ... The ribonucleoprotein complex was formed by combining 150nM Cas9 enzyme with 150nM of each guide in 1X CutSmart buffer (NEB) and the 23.5μL reaction was incubated at 25°C for 10 minutes ...
-
bioRxiv - Genomics 2021Quote: ... Then the cells were incubated with 200nM Cas9-sgRNA ribonucleoprotein complex in the binding buffer with 1U/ul T7 exonuclease (NEB, M0263) for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribonucleoprotein complexes of SpCas9 protein (NEB; Ipswitch, MA), ssODN template and gRNA were prepared with final concentration 200 μg/μl ...
-
bioRxiv - Genomics 2020Quote: Transfection of gRNA and Cas9 ribonucleoprotein (EnGen SpyCas9, New England Biolabs) into mESCs was performed using Neon Transfection System ...
-
bioRxiv - Molecular Biology 2020Quote: ... reverse primer ACA AGG GCT TTC TCT CAT AAT GAG ATG CTC and the Q5® Site-Directed Mutagenesis Kit (New England Biolabs). Cells were transfected with 50 nM siRNA using Dharmafect 1 for 48 h ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Genomics 2024Quote: ... in the presence of 1% VRC (Vanadyl Ribonucleoside Complex; NEB, S1402S). Coverslips were then rinsed 3 times in 70% EtOH and stored at -20C ...
-
bioRxiv - Cell Biology 2021Quote: ... Ribonucleoprotein (RNP) complexes were formed from sgRNA and recombinant Cas9 2NLS protein (New England Biolabs) mixed at a sgRNA to Cas9 ratio of 4.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNase H diluted (1:100) in 1× RNase H buffer (New England Biolabs) was added to the cells and incubated for 2 h at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... Ribonucleoprotein injection mix was prepared with 1.30 μl of Cas9 enzyme (20 μM, New England BioLabs), 1.60 μl of prepared gRNAs ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.2% vanadyl ribonuceloside complex (NEB)] and frozen at –80°C for at least 30 min ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.2% vanadyl ribonuceloside complex (NEB)] and frozen at –80°C for at least 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM EGTA and 2 mM Vanadyl Ribonucleoside complex (VRC, New England Biolabs), washed three times with 70% ice-cold ethanol and kept at −20°C.
-
bioRxiv - Bioengineering 2020Quote: ... a 10x Cas12-gRNA complex was prepared using 1 μM of LbCas12a (NEB) and 0.5 μM of Cy5-labeled gRNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNase-free BSA (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RVC (Ribonucleoside Vanadyl Complex, NEB, S1402) and ssDNA+ tRNA in 2× SSC ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM Ribonucleoside Vanadyl Complex (NEB), Roche cOmplete™ ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Systems Biology 2020Quote: ... 2mM Vanadyl ribonucleoside complex (NEB S1402S), and 0.1% Tween 20 (VWR 97062-332 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB)) supplemented with 50 ng of Cy5-oligo-dT45 probe for 12 hr at 37°C in the dark ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...
-
bioRxiv - Genomics 2022Quote: ... 10 mM ribonucleoside vanadyl complex (NEB). Dissociated tissue was filtered through a 70 uM cell strainer on ice and washed with an additional 5 mL of ice-cold lysis/fixation buffer ...
-
bioRxiv - Genetics 2022Quote: ... 2mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 mM Ribonucleoside Vanadyl Complex (NEB), 0.2% v/v Triton X-100and 0.12 U/μL SUPERase•In™ RNase Inhibitor) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10mM ribonucleoside vanadyl complex (NEB, S1402S), 2μg salmon sperm DNA (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.2 mM vanadyl complex (NEB). 5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of RNase H (NEB), 1 μL of E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 1 uL RNase H (NEB) and incubated at 37C for 15 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... an RNA-protein complex was formed with 1 µM Cas9 protein (New England Biolabs) and 1 µM gRNA pool (3 gRNAs in total ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 2 mM ribonucleoside-vanadyl complex (NEB) for 30 minutes at 30ºC before overnight incubation with 10nM probes in hybridization buffer (10% (w/v ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM ribonucleoside vanadyl complex (NEB S1402S), 100 units/mL SUPERase In (Thermo Fisher AM2694) ...
-
bioRxiv - Microbiology 2021Quote: ... 2mM vanadylribonucleosid complex RNase inhibitor (NEB, USA)) ...
-
bioRxiv - Biophysics 2022Quote: ... 2 mM ribonucleoside vanadyl complex (NEB, S1402S), 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2mM vanadyl-ribonucleoside complex (New England Biolabs), and 10.6% dextran sulphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... Ribonucleoside vanadyl complex (New England Biolabs, S1402S). Formamide (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM ribonucleoside vanadyl complex (NEB, S1402S), 100 units/mL SUPERaseIn (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM vanadyl ribonucleoside complex (NEB, S1402S). The cells were then washed 4 times in wash buffer containing 25% formamide (Roche ...
-
bioRxiv - Genetics 2024Quote: ... 2 mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB, S1402S)) and incubated overnight at 37°C in a humidified chamber ...
-
bioRxiv - Molecular Biology 2024Quote: ... vanadyl ribonucleoside complex (VRC; New England Biolabs) was added to the NPB at a concentration of 10 mM ...
-
bioRxiv - Cell Biology 2024Quote: ... + 2 mM vanadyl-ribonucleoside complex (NEB S1402) + 0.02% [w/v] BSA ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl RNase H (New England BioLabs), 1 μl 10X RNase H Reaction Buffer ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl RNase H (New England BioLabs), 1 μl 10X RNase H Reaction Buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μL RNase H (New England Biolabs) was added to the mixture to digest the RNA ...
-
bioRxiv - Biochemistry 2023Quote: Trx-linker concatemers (1 mg/mL) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (PKA) (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in protein kinase buffer (50 mM Tris HCl ...