Labshake search
Citations for New England Biolabs :
1 - 50 of 8824 citations for Human Cathepsin B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PURExpress® kit containing Solution A and Solution B (NEB) was used to prepare the transcription-translation reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Biophysics 2021Quote: ... coli B ER2566 from NEB; ampicillin ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Microbiology 2019Quote: ... 7.5 μL solution B (NEB #E6800), 2 μL E ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl Exo-CIP Tube B (NEB) were mixed and incubated at 37°C for 4 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs) according to the manufacturer’s instructions without modifications ...
-
bioRxiv - Cancer Biology 2019Quote: ... Barcode cassette was amplified from genomic DNA with primers P5.seq-B-GLI.v1 and P7.seq-B-GLI.v1 using OneTaq® DNA Polymerase (NEB, cat ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from IgG1 stimulated B cells 72 hour post-stimulation using TRIzol reagent (Fisher) and cDNA was prepared using the Protoscript II kit (NEB). Germline transcription was analyzed using quantitative PCR with SYBR Green (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: DNA from human cells was isolated using the Monarch®Genomic DNA Purification Kit (NEB) following the manufacturer’s instructions and including the recommended RNaseA digestion step ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: RNA from human cells was isolated using the Monarch®Total RNA Miniprep Kit (NEB) following the manufacturer’s instructions and including the on-column DnaseI digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... bovine RNase B and fetuin (New England Biolabs) by PNGase F (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... library was prepared using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). The RNA-Seq libraries were sequenced on NextSeq 500 using the NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Microbiology 2022Quote: ... Clean RNA was first rRNA depleted using the NEBNext rRNA depletion kit (Human/Mouse/Rat) (NEB) before being prepared for sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) according to the manufacturer’s instructions with 6 µl total RNA used as input per sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext rRNA Depletion Kit v2 (Human/ mouse) (NEB #E7405), NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Microbiology 2020Quote: ... B are ligated first by T4 DNA ligase (NEB) in 40μl system ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Genetics 2024Quote: ... The B splice form (Spc105RB) was generated using site directed mutagenesis to delete the first intron from the A form (NEB BaseChanger Kit). All mutants were generated using site specific mutagenesis of the A- or B-form Spc105R coding region in the pENTR4 vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... We then carried out rRNA depletion with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat NEB # E6310S) using the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Complementary DNA (cDNA) encoding for Human CD36 (RC221976) was cloned using Hifi DNA assembly kit (NEB E5520S) into the pJFRC-MUH vector (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... and libraries were prepared using the NEBNext rRNA Depletion Kit for Human/Mouse/Rat (NEB Cat#E6310). Adapter-ligated cDNA was amplified with 11 cycles of PCR to generate libraries ∼300 bp in length ...
-
bioRxiv - Biochemistry 2021Quote: ... 125 to 75 U/ 5 μg RNase B (Cat.P7817S, NEB) and fetuin (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9 protein (IDT) was suspended with a Diluent B (NEB) to make 1 μM solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Biochemistry 2022Quote: ... RNase B from bovine pancreas (New England Biolabs, Ipswich MA, USA), and horse radish peroxidase (HRP ...
-
bioRxiv - Microbiology 2024Quote: ... coli B strain was dephosphorylated with 0.4 U/µL QuickCIP (NEB) in 1 x rCutSmart buffer (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... Leishmania DNA (0.0017 ng/μL) was then enriched from the human DNA (25ng/μL) using NEBNext Microbiome DNA Enrichment Kit (NEB) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...