Labshake search
Citations for New England Biolabs :
1 - 50 of 3267 citations for Human β Amyloid 1 42 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... digested O/N at 42°C with 3U β-agarase (New England Biolabs) and again for 2 hrs with 2U β-agarase ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Samples were cooled to 42 °C and 2 μl of β-agarase I enzyme (NEB) was added and incubated at 42 °C for 90 min with occasional vortexing ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting solution was cooled down to 42°C before adding 2 U of β-agarase (NEB), gently mixing the solution by end-over-tube inversion ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The solution was then equilibrated to 42°C for 10 min before adding 2 μL of β-agarase (NEB). Finally ...
-
bioRxiv - Cell Biology 2021Quote: ... The tubes were cooled at 42 °C for 10 min before addition of 3 μl of β-agarase (NEB) dissolved in 100 μl MES solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were then incubated at 42°C overnight with the addition of 3 μl of β-agarase (NEB). The DNA mix was then gently poured into combing reservoirs containing 1.2 ml MES and the genomic DNA was combed onto salinized coverslips (Genomic Vision ...
-
bioRxiv - Molecular Biology 2020Quote: ... The solution was transferred to 42°C for 15 min and incubated overnight in 3 U of β-agarase I (New England Biolabs, M0392). Next ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl β-agarase (NEB M0392S) was added and mixed by flicking without allowing sample to cool ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl β-agarase (NEB M0392S) was added and mixed by flicking without allowing sample to cool ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl β-agarase (NEB M0392S) was added and mixed by flicking without allowing sample to cool ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl β-agarase (NEB M0392S) was added and mixed by flicking without allowing sample to cool ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... [42] using the Q5 site-directed mutagenesis kit (NEB) or ordered as cr:tracrRNAs from Synthego ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA synthesis was performed for 1 h at 42°C using M-MuLV reverse transcriptase (200 U, NEB) followed by a heat-inactivation at 80°C for 5 min ...
-
bioRxiv - Biophysics 2022Quote: ... The agarose was digested by 1 hour incubation at 42 °C with 2 units of beta-agarase (M0392, New England Biolabs). After this stage ...
-
bioRxiv - Developmental Biology 2022Quote: ... and cDNA synthesis was performed in 20 μl at 42°C for 1 hour using AMV reverse transcriptase (NEB, M0277) and 5 μl of the RT reaction was amplified in 25 μl using AccuPrime Pfx DNA polymerase (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Bioengineering 2023Quote: ... 42 The resulting gBlocks were ligated into pSTEPL plasmids using Gibson assembly (NEB) and transformed into chemically competent SHuffle T7 Express E.coli (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... MBP::CDC-42 coding sequence was inserted into the pMAL-c5X plasmid (NEB). The S71A mutation was introduced into the pMALc-MBP::CDC-42 plasmid with the QuickChange II XL Site directed mutagenesis kit (#200521 ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of human recombinant histone H4 (BioLabs, Cat# M2504S) was incubated with 50 μM n-butyryl- or isobutyryl-CoA and 0.2 μM of HAT1 at 30 °C for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... transferred to 42°C and digested by immediate addition of 2ul of beta-agaraseI (NEB) per 300ul of melted gel and incubation at 42°C for 1h ...
-
bioRxiv - Molecular Biology 2021Quote: ... was isolated by β-agarase (NEB) digestion and amplified by whole genome amplification (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... and β-GlcNAcase S (P0744, NEB). In reactions containing α-mannosidase and for all experiments shown in Fig ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1,2 U β-agarase (NEB, M0392) per mL MES buffer was added to the solution and incubated at 42 °C overnight ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and immediately adding 1 U of β-agarase I per 100 ul of molten gel (NEB). The mixture was incubated at 42°C for 60 min to release DNA bound in the agarose matrix ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and β-actin (13E5, HRP-conjugated, NEB). Membranes were washed with TBS-T and incubated with HRP-linked secondary antibodies prior to detection with Clarity-ECL chemiluminescence reagent (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... 2 μL of β-agarase (NEB M0392S) and 2 μL of RNAse A (Roche 1 119 915 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and digested overnight with β-agarase (NEB M0392). DNA was then subsequently combed onto commercially available vinyl silane-coated coverslips (Genomic Vision COV-001) ...
-
bioRxiv - Genomics 2023Quote: ... 0.75 μL T4 Phage β-glucosyltransferase (NEB M0357S), and 12.45 μL water ...
-
bioRxiv - Biophysics 2020Quote: ... ssM13mp18 at a concentration of 42 nM was mixed with 0.42 µM primer in NEBuffer 2.1(New England Biolabs). Samples were heated to 90°C for 30 seconds and cooled to 25°C at 0.1°C/sec ...
-
bioRxiv - Bioengineering 2023Quote: ... The RT-RPA was performed at 42°C for 30 min by combining M-MuLV-RT (NEB #M0253L) with TwistAmp Basic (TwistDx #TABAS03KIT) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid transformation was achieved by using the heat shock method (42°C, 47s) in DH5α competent cells (NEB, C2987H), then purified with QIAGEN Plasmid Plus Midi Kit (QIAGEN ...
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Genomics 2022Quote: ... 30 units of T4 β-glucosyltransferase (New England Biolabs) and ultra-pure water in a final volume of 45 μL ...
-
bioRxiv - Genomics 2023Quote: ... and digested with 2 units of β-agarase (NEB) per block (1 hr. ...
-
bioRxiv - Genomics 2023Quote: ... and digested with 2 units of β-agarase (NEB) (42°C ...
-
bioRxiv - Genomics 2024Quote: ... 30 units of T4 β-glucosyltransferase (New England Biolabs) and ultra-pure water in a final volume of 45 µL ...
-
bioRxiv - Cell Biology 2021Quote: One plug per sample was melted at 68°C in 1 mL 100 mM MES buffer pH 6.5 prior to addition of β-agarase (New England Biolabs) and incubation overnight at 42°C ...
-
bioRxiv - Cell Biology 2020Quote: ... at 68°C for 20 min and transferred to 42°C where 1.5 μL of ß-agarase (New England Biolabs) was added and incubated overnight ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed for 5 hours at 42 °C using 100 U of ProtoScript® II Reverse Transcriptase (NEB), 10 U of RNase Inhibitor (Murine ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The PCR product and the plasmid pT1-3B (42) was digested with the restriction enzymes Sal1 and HindIII (New England Biolab (NEB)) ...
-
bioRxiv - Biochemistry 2021Quote: ... The floated fraction corresponding to a mixture of high- and low-density EVs (42) was treated with MNase (NEB, M0247S) to degrade any nucleic acid not contained within the EVs and deactivated with 25 mM ethylene glycol-bis(β-aminoethyl either)-N,N,N′,N′-tetraacetic acid (EGTA ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed for 60 min at 42 °C and 5 min at 80 °C using ProtoScript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli and by performing heat shock for 30 seconds at 42°C followed by recovery in SOC outgrowth medium (NEB) for 1 hour ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... to the branch point recognition sequence (Nucleotides 18-42) of U2 snRNA and to GAPDH mRNA were added in combination with RNase H (NEB) to NE ...
-
bioRxiv - Biochemistry 2023Quote: ... after which the soluble supernatant was filtered (0.45 μm) and loaded onto a 42-mL column packed with amylose resin (NEB #E8021L) equilibrated with Buffer A3 (20mM Tris pH 7.5 ...
-
bioRxiv - Plant Biology 2019Quote: ... Expression of recombinant proteins was performed at 25°C for 4 h with 0,3 mM Isopropil-β-D-1-tiogalattopiranoside (IPTG) and affinity purification was obtained by using the amylose resin affinity matrix (New England Biolabs) in a buffer containing 60 mM HEPES-KOH pH 8.0 ...
-
bioRxiv - Microbiology 2022Quote: ... the CPER product was subject to post-PCR nick sealing for 30 min at 50°C and 30 min at 60°C in a 25 μL reaction containing 1 mM β-nicotinamide adenine dinucleotide (NAD+) (NEB) and 0.5 μL HiFi Taq DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and digested overnight with <ι>β-agarase (NEB M0392). DNA combing was performed using commercially available coverslips (Genomic Vision COV-001) ...