Labshake search
Citations for New England Biolabs :
1 - 50 of 354 citations for Hemoglobin subunit zeta HBAZ Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: Codon-optimized human TDP-43-His LIC-A constructs were transformed into T7 express (New England Biolabs, #C3029J) E ...
-
bioRxiv - Neuroscience 2020Quote: ... a catalytic subunit of protein kinase A (PKA Cα, New England Biolabs); Ca2+/calmodulin-dependent protein kinase II (CaMKII ...
-
bioRxiv - Cancer Biology 2020Quote: ... with Hi-Fi DNA builder (NEB). Primers used to amplify specific regions are described in (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Exchange of V5/His to myc/His was performed using the Q5 site-directed mutagenesis kit (NEB #E0554) according to the manufacturer’s protocol resulting in pEF1-ZAP-S-myc/His and pEF1-ZAP-L-myc/His ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomes with a spytag labeled L17 subunit was used during in vitro translation system (NEB, E3313S) to generate the stalled RNC ...
-
bioRxiv - Biophysics 2022Quote: ... 2018) and a C-terminal 6x His tag and cloned into the pET21B vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biophysics 2022Quote: ... The DNA fragment was amplified by PCR by inserting a C-terminal 6x His tag and cloned into the pETDUET-1 vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biochemistry 2021Quote: ... 25 U Hi-T7 RNA polymerase (NEB #M0658), 250 nM RNaseAlert™ QC System v2 (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... Single-construct plasmids expressing A-subunits were constructed via restriction digestion (NdeI and PstI, New England Biolabs) and ligation using pBAD24 (Amp+ ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was cut with Hind III and Bam HI (NEB) for 1h at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... and His-MBP-ZFC3H1 onto an Amylose resin (NEB). After extensive washing ...
-
bioRxiv - Immunology 2021Quote: ... were assembled using Hi-Fi DNA Assembly Mix (NEB). For the SFFV-Cas9 vector ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10µg/ml) and apyrase (25mU/ml, NEB); the suspension was incubated for 1h at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Hi-Fi assembly from New England BioLabs (NEB) and other basic molecular cloning approaches ...
-
bioRxiv - Genomics 2021Quote: ... was then inserted by Hi-Fi assembly (NEB, E2621) using 0.025 pmols of vector and 0.05 pmols of the GFP amplicon ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEB Hi-Fi assembly mix (New England Biolabs). A mixture of the two guide plasmids (each at 100ng/µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... We expressed the His-SUGCT in Lemo cells (NEB), inoculating 4L of TB with 4 mL overnight culture ...
-
bioRxiv - Microbiology 2019Quote: ... or Bam HI and Xho I (New England BioLabs, MA). The column isolated DNA fragments were ligated into our modified pFastBac1 plasmid having 6xHis tag at C-terminus ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified via PCR with NEBNext Hi-fidelity enzyme (NEB). The resulting next-generation sequencing libraries were sequenced on a HiSeq2500 (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... Followed by subcloning the PCR amplicon in Bam-HI (NEB) restriction digested pCW57-tGFP-2A-MCS plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEBuilder Hi-Fi Assembly (New England Biolabs, Cat. #E2621). The pMB1052 construct was subsequently cut using BspDI and EcoRV (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR with NEBNext Hi-fidelity enzyme (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... The Hi-Scribe T7 High Yield RNA synthesis kit (NEB) was used to generate RNA transcripts at 37°C for 16 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... using the NEBuilder Hi-Fi Assembly kit (New England Biolabs). To ensure representation of all variants in the population ...
-
bioRxiv - Cancer Biology 2023Quote: ... cut with hi-fidelity EcoRI and BamHI (New England Biolabs), and gel purified ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... To perform in vitro phosphorylation 5 μg of purified GST-NL2CT (WT or S714D) fusion protein was incubated with 2.5kUnits purified catalytic subunit of PKA (NEB) supplemented with 200 μM ATP at 30°C for the indicated time points.
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs encoding each of the CBAF subunits were PCR-amplified using Phusion DNA polymerase in HiFi Phusion buffer (NEB) and subcloned into pLibMam vectors using NEBuilder HiFi (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Trx-linker concatemers (1 mg/mL) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (PKA) (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in protein kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 4.1 μl of PLPPR3 ICD (final concentration 0.075 mg/ml) was mixed with 0.2 μl purified PKA catalytic subunit (final concentration 20 000 Units; #P6000S, Biolabs), 0.8 μl phosphorylation buffer (final concentration of 25 mM HEPES ...
-
bioRxiv - Molecular Biology 2019Quote: ... for the presence of all core TFIIH subunits and appropriate fractions were pulled and mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in washing buffer (400 mM KCl ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... proteolytic subunits were removed from the expression constructs using blunt end deletion following a standard Q5 mutagenesis workflow (New England Biolabs). Additionally ...
-
bioRxiv - Biophysics 2023Quote: ... To enrich for fully assembled TC-TL complexes the expressome was purified via immobilizing the 50S subunit (ZS22) onto streptavidin magnetic beads (NEB). For this ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 200 µM ATP with ot without 1 µl of recombinant PKA catalytic subunit (PKAc; New England Biolabs) in manufacturer-supplied reaction buffer at 30° C for 30min with agitation ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The two fragments were assembled using HI-FI assembly (NEB E5520S). To construct the Prcan-1-R1∷mCherry and Prcan-1-R2∷mCherry plasmids ...
-
bioRxiv - Immunology 2021Quote: ... The fragments were assembled using Hi-Fi DNA Assembly Mix (NEB). For the DonorgRNA vector ...
-
bioRxiv - Genomics 2021Quote: ... and 25 µl 2x NEBNext Hi-Fi PCR mix (NEB, USA) per reaction ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10 μg/mL) and apyrase (25 mU/mL, NEB); the suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Nb35–His (10 µg/ml) and apyrase (25 mU/ml, NEB). The suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: His-MBP-Fbp17SH3 was precipitated by amylose beads (NEB; cat#E8021L). After purification ...
-
bioRxiv - Plant Biology 2022Quote: ... and MBP-HIS-GFP proteins were purified with amylose resin (NEB) and SUMO-HIS-BIN2 protein was purified with Ni-NTA Agarose (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... For all Gibson Assemblies the NEB Hi-Fi Assembly Mastermix (NEB) was used ...
-
bioRxiv - Genetics 2023Quote: ... To facilitate homology directed assembly (Gibson or NEB Hi Fi assembly), 30bp homology with the preferred SEED cassettes were included at each site of the BsaI sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... For his purpose pEKEx2 was first linearized using SacI (NEB, USA). The gene for mCherry was amplified by PCR using the primer pairs low_mCherry_fw and low_mCherry_rev (Table S1 ...
-
bioRxiv - Cell Biology 2021Quote: ... were subcloned into phCMV3 to express C-terminal FLAG-tagged CatSper subunits (phCMV3-CatSperd or z-Flag) using NEBuilder® HiFi DNA Assembly Kit (NEB). A stop codon was placed at the upstream of HA-encoding sequences of phCMV3 vector for FLAG-tagged CatSper subunit cloning.