Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... using the High Sensitivity DNA Assay and NEBNext Library Quant Kit for Illumina (NEB, E7630). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were qualified on Agilent 2100 Bioanalyzer using High Sensitivity DNA kit and quantified by qPCR using NEBNext Library Quant kit for Illumina (NEB, E7630). Equal molarity of each library were pooled and subjected to sequencing on Illumina HiSeq 4000 and NovaSeq 6000 platforms at the McGill University and Génome Québec Innovation Centre to generate 50 bp paired-end reads.
-
bioRxiv - Molecular Biology 2022Quote: ... Library quality was checked by Agilent BioAnalyzer 2100 using the High Sensitivity DNA kit (Part number 5067-4626) and libraries were quantified using the Library Quant Kit for Illumina (NEB #7630). Libraries were then sequenced using a NextSeq500 platform (75-base-pair (bp ...
-
bioRxiv - Molecular Biology 2023Quote: Libraries were qualified on Agilent 2100 Bioanalyzer using High Sensitivity DNA Kit and quantified by qPCR using NEBNext Library Quant Kit for Illumina (NEB, E7630). Equal molarity of each library was pooled and subjected to sequencing on Illumina NovaSeq 6000 platform at the McGill University and Génome Québec Innovation Centre to generate 100 bp paired-end reads.
-
bioRxiv - Microbiology 2020Quote: ... Final Illumina libraries were assessed for quality using an Agilent Bioanalyzer DNA High Sensitivity Assay and qPCR quantification was performed using NEBNext Library Quant kit for Illumina (New England Biolabs). Individual libraries were pooled equimolarly ...
-
bioRxiv - Systems Biology 2019Quote: ... The final pool was run on an Agilent Bioanalyzer dsDNA High Sensitivity chip and quantified using NEBNext Library Quant Kit for Illumina (New England Biolabs, E7630L). The quantified pool was hybridized at a final concentration of 400 pM and sequenced paired-end on the Illumina NovaSeq6000 platform using a S2 flowcell at 2×151 bp read lengths.
-
bioRxiv - Microbiology 2020Quote: ... quality-controlled using Agilent Bioanalyzer (High Sensitivity DNA chip) digested with USER enzyme (NEB) and quantified by qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μL of WarmStart Colorimetric Lamp 2X Master Mix (M1800) (New England Biolabs, USA), 5 μL of DNAse ...
-
bioRxiv - Molecular Biology 2020Quote: ... The final pool was run on an Agilent Bioanalyzer dsDNA High Sensitivity chip and quantified using NEBNext Library Quant Kit for Illumina (cat # E7630L, New England Biolabs, Ipswich, USA).”
-
bioRxiv - Microbiology 2023Quote: ... The final pool was run on an Agilent Bioanalyzer dsDNA High Sensitivity chip and quantified using NEBNext Library Quant Kit for Illumina (cat # E7630L, New England Biolabs, Ipswich, USA).
-
bioRxiv - Physiology 2022Quote: ... EnGen Mutation Detection Kit (New England BioLabs) was used for amplification of target DNA ...
-
bioRxiv - Microbiology 2022Quote: ... WarmStart Colorimetric LAMP 2X Master Mix (NEB) was used with 0.4 μM SYTO-9 (Thermo Scientific).
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: Bead-LAMP using Phenol Red as colorimetric read-out (Figure S5G) was performed with WarmStart colorimetric LAMP 2x master mix (NEB) instead of the HNB containing RT-LAMP mix.
-
bioRxiv - Microbiology 2023Quote: RT-LAMP reactions were done using the WarmStart Colorimetric LAMP 2X Master Mix kit (M1800, NEB, Hitchin, UK) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Phusion high fidelity DNA polymerase kit (NEB) was used for the PCR amplification and optimized with DMSO and formamide ...
-
bioRxiv - Microbiology 2020Quote: ... When using WarmStart Colorimetric LAMP 2X Master Mix (NEB), same concentrations of primers and 0.4 μM SYTO-9 were added ...
-
bioRxiv - Molecular Biology 2022Quote: ... high yield in vitro transcription (HiScribe T7 Quick High Yield RNA Synthesis Kit, NEB), and cDNA synthesis reactions (Maxima H Minus Reverse Transcriptase ...
-
bioRxiv - Genomics 2022Quote: ... using the Phusion High-Fidelity PCR Kit (NEB). Resulting products were cloned into the pGL4.23 luciferase reporter vector (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... HiScribe T7 High Yield RNA Synthesis Kit (NEB) was used for in vitro transcription ...
-
bioRxiv - Genomics 2023Quote: ... using the Phusion High Fidelity PCR kit (NEB) using primers designed to span the ATAC-seq signals (Table S7 ...
-
bioRxiv - Genetics 2023Quote: ... with Phusion high-fidelity DNA Polymerase Kit (NEB), Common sgRNA-R and Primer 1 or Primer 2 (see below).
-
bioRxiv - Genetics 2024Quote: ... with Phusion high-fidelity DNA Polymerase Kit (NEB), Common sgRNA-R and Primer 1 or Primer 2 (see below).
-
bioRxiv - Cell Biology 2022Quote: ... Editing efficiency was assessed using the EnGen Mutation Detection Kit (NEB) (E3321S ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 10 μl NEBNext 2x High-Fidelity Master Mix (New England Biolabs), 0.3 μM of each primer ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μg of linearized plasmid was used as template in a 10 µL reaction using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040S) with an 8:1 ratio of cap analog to GTP ...
-
bioRxiv - Plant Biology 2020Quote: ... respectively by Phusion® High-Fidelity PCR Kit (NEB) (Harashima & Schnittger ...
-
bioRxiv - Microbiology 2020Quote: ... A HiScribe T7 High Yield RNA Synthesis Kit (NEB) was used for RNA synthesis ...
-
bioRxiv - Microbiology 2022Quote: ... HiScribe™ T7 High Yield RNA synthesis kit (NEB) was used as per the manufacturer’s protocol with Biotin Labelling RNA Mix (Roche ...
-
bioRxiv - Biophysics 2022Quote: ... and Q5 High-Fidelity PCR Kit (New England BioLabs). Plasmids were transformed in E ...
-
bioRxiv - Bioengineering 2020Quote: ... Q5 High-Fidelity PCR Kit was purchased from NEB.
-
bioRxiv - Microbiology 2020Quote: ... The HiScribe T7 High Yield RNA Synthesis Kit (NEB) was used to generate dsRNA from the purified T7-tagged amplicons ...
-
bioRxiv - Bioengineering 2023Quote: ... HiScribeT7 Quick High Yield RNA synthesis kit (NEB E2050S) and Monarch RNA Cleanup Kit (NEB T2040L ...
-
bioRxiv - Molecular Biology 2023Quote: The Q5 High-Fidelity Polymerase kit (Cat# M0493, NEB) was used for amplification (5 μL 5× Q5 reaction buffer ...
-
bioRxiv - Microbiology 2020Quote: ... we used a colorimetric assay using p-Nitrophenyl phosphate (pNPP) (NEB) as a substrate ...
-
bioRxiv - Molecular Biology 2021Quote: RT-LAMP reactions were performed using either WarmStart® Colorimetric LAMP 2X Master Mix (DNA & RNA) (M1800) or WarmStart® LAMP Kit (DNA & RNA) (E1700) from New England Biolabs (NEB). 40 mM guanidine hydrochloride was included in all reactions to improve LAMP reaction speed and sensitivity [10] ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA (5-10 μg) derived from transfected ESC was digested by high concentrated HindIII-HF or high concentrated BamHI-HF (NEB). In all Southern blot analyses ...
-
bioRxiv - Genetics 2019Quote: ... and transformed into high efficiency 10-beta competent E.coli (New England BioLabs) to generate pDestTol2pA2_ubi:f5-p2A-EGFP ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 µL Q5® High GC Enhancer (New England BioLabs, Inc., B9028AVIAL), 0.5 µL Q5® High-Fidelity DNA Polymerase (New England BioLabs ...
-
bioRxiv - Immunology 2022Quote: ... The HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB) was used to transcribe RNAs in vitro following the manufacturer’s recommended protocols and the resultant RNAs were purified with an EasyPure RNA Kit (TransGen Biotech ...
-
bioRxiv - Biophysics 2022Quote: ... using a Phusion High Fidelity kit (New England Biolabs # E0553L). The reverse transcription product was diluted 5-fold with water and 2 uL were used in a 25 uL PCR reaction according to the manufacturer’ s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... erosus using the Q5 Hot Start High-Fidelity kit (NEB). Primers used in the reaction are listed in Suppl ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Hi-Scribe T7 High Yield RNA synthesis kit (NEB) was used to generate RNA transcripts at 37°C for 16 hours ...
-
bioRxiv - Synthetic Biology 2024Quote: Using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) 1 µg of the amplified and linearized DNA construct was transcribed in an 80 µL reaction volume and incubated overnight at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... The HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S) was used to transcribe the template DNA per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The probe was detected by chemiluminescence using the Phototope-Star Detection Kit (NEB) and autoradiographic film ...
-
bioRxiv - Molecular Biology 2023Quote: ... Editing activity of α-synCas was evaluated using EnGen Mutation Detection Kit (NEB). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted genome DNA was used to amplify the surrounding region of the m.15059G>A mutation for T7 Endonuclease I (T7EI) mismatch detection assay using Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs, USA) in accordance with recent studies 27 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1/10 T7 RNA polymerase mix (HighScribe T7 High Yield RNA synthesis NEB)) at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl of Q5 Hot Start High-Fidelity 2x Master Mix (NEB M0494S), 1 μl of 10 μM shRNA_GA_F primer (5’ GAGAACTCTGAATAGATCTGTTCTAGAAAACATCCCATAAAACATCCCATATTCA-3’) ...