Labshake search
Citations for New England Biolabs :
1 - 50 of 3392 citations for Glucosamine Phosphate N Acetyltransferase 1 GNPNAT1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and chloramphenicol acetyltransferase from pEVS143 with BamHI and EcoRI digests (NEB) (23) ...
-
bioRxiv - Bioengineering 2022Quote: ... or 1 μg Asp-N (NEB, England) for overnight digestion respectively ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM CaCl2 and treated with N-glycanase (New England Biolabs) for 1 hour at 37°C.
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were amplified for N-1 cycles (being N the optimum Cq determined by qPCR reaction) using NEBNext High-Fidelity Polymerase (New England Biolabs, M0541). Libraries were purified with Sera-Mag Select Beads (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... After incubation with 5‘-phosphate-dependent exoribonuclease XRN-1 (New England BioLabs, Inc., USA), samples were treated with RNA 5‘ polyphosphatase (Lucigen) ...
-
bioRxiv - Genetics 2019Quote: ... and 2.0 units of the CspCI enzyme ((N)10-11CAA(N)5GTGG(N)12-13) (New England Biolabs). The library preparation was carried out according to the protocol proposed by Osorio-Guarín et al ...
-
bioRxiv - Microbiology 2020Quote: ... 30 mM acetyl phosphate or 1 µl Calf Intestinal Alkaline Phosphatase (CIP) (NEB, catalog#: M0290V) was added to the solution ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was digested with 2.0 units of the BsaXI enzyme ((N)9AC(N)5CTCC(N)10) (New England Biolabs) and 2.0 units of the CspCI enzyme ((N)10-11CAA(N)5GTGG(N)12-13 ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: ... 1 unit of λ-phosphatase is defined as the amount of enzyme that hydrolyzes 1 nmol of p-nitrophenyl phosphate in 1 minute at 30°C (New England Biolabs). After 45 minutes of incubation ...
-
bioRxiv - Cell Biology 2021Quote: 500mM p-Nitrophenyl Phosphate (pNPP, NEB, P0757S) substrate solution was diluted to 20 mM in phosphatase reaction buffer (PRB ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of 10 mM dNTP (cat. n° N0447L, NEB, New England Biolabs, USA), 0.2 µL of RNase Inhibitor 40 U / µL (cat ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of 10 mM dNTP (cat. n° N0447L, NEB, New England Biolabs, USA), 0.2 µL of RNase Inhibitor 40 U / µL (cat ...
-
bioRxiv - Biophysics 2024Quote: ... N-glycosylation was removed by a 1-hour incubation with PNGase F (500 U, NEB) and following digest with sequence-grade trypsin (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN, N is for a random nucleotide) by T4 ligase 1(NEB) sequentially ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.5 and de-N-glycosylated using 500 U N-glycosidase F (PNGase F, New England Biolabs) for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-phosphate was added via T4 polynucleotide kinase (NEB) at 37 ºC for 30 minutes ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
bioRxiv - Neuroscience 2023Quote: ... N-glycans were released using N-glycanase PNGase F (1239U/ml, New England BioLabs, Inc. cat no. P0709L) and were fluorescently labelled with 2-aminobenzamide (2-AB ...
-
bioRxiv - Immunology 2020Quote: ... deglycosylated with N-glycanase (New England Biolabs), and digested overnight with LysC protease (ThermoFisher scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... or N-glycosilase F (PNGaseF, NEB P0704S), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... endoproteinase Asp-N (New England Biolabs, #P8104S), Glu-C (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat. n° M0314L NEB, New England Biolabs, USA), 2 µL of random primer mix 60 µM (cat ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat. n° M0314L NEB, New England Biolabs, USA), 2 µL of random primer mix 60 µM (cat ...
-
bioRxiv - Microbiology 2020Quote: ... we used a colorimetric assay using p-Nitrophenyl phosphate (pNPP) (NEB) as a substrate ...
-
bioRxiv - Cancer Biology 2024Quote: ... and treated with 800 U of Lambda Phosphates (New England Biolabs) for 30 min at 30°C ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Biochemistry 2020Quote: ... Trypsin digest of PDI was followed by digestion of N-glycans with endo-β-N-acetylglucosaminidase H (500 U; NEB) in sodium citrate buffer (50 mm ...
-
bioRxiv - Microbiology 2020Quote: ... samples were washed in phosphate buffered saline (PBS) and labelled with 1:500 of 10mg/mL Hoechst 33342 (New England Biolabs, Cat# 4082S) for 10 min with a subsequent wash in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... Peptide-N-Glycosidase F (PNGase F; NEB, P0704) treatment of lysates was performed as described in the manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli BL21 lysY/Iq (NEB cat n° C3013). The expression plasmid was transformed via heat-shock followed by selection of clones on LB-Agar plates supplemented with 100 µg/mL carbenicillin ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... pHAGE lentiviral plasmids encoding the six other HCoV N-EGFP were generated by replacing SARS-CoV-2 N with the respective HCoV N sequences by PCR (New England Biolabs M0492S) and NEBuilder HiFi DNA Assembly (New England Biolabs E2621S) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed cells were resuspended in 1 mL spheroplast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB S1402S], 20 µM beta-mercaptoethanol), and 1.2–5 µL 100T zymolyase (US Biological Z1005 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: The α-(1,2)-Galf-containing N-linked glycans were released from 1 mg Transglucosidase L “Amano” (Amano) by using PNGase F (New England Biolabs) under denaturing conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Peptide-N-glycosidase F (PNGase F) (New England BioLabs) was used to remove all N-linked oligosaccharides for 1 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... as N-terminal VP16 fusions using HiFi assembly (NEB). The human ERG ETS domain ...
-
bioRxiv - Microbiology 2022Quote: ... or for peptide N-glycosidase F (PNGase-F, NEB) digestion using 500 units PNGase-F for 1,5h at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... the sample was deglycosylated with N-glycosidase F (Biolabs) and Sialidase A (Prozyme ...
-
bioRxiv - Biochemistry 2023Quote: ... N-glycans were released with PNGase F (NEB, P0709) for 20 h at 37 °C and the released N-glycans were isolated by passage through a pre-washed 10 kDa MWCO filter ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2.5mM Na2P2H2O7 and 20mM β-glycerol phosphate) and 10mM ATP (New England Biolabs) to a total volume of 50µl ...
-
bioRxiv - Plant Biology 2022Quote: ... and 6 µM p-Nitrophenyl Phosphate (pNPP) (New England Biolabs Catalog Number P0757S) at 25°C at a pH of 5.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).