Labshake search
Citations for New England Biolabs :
1 - 50 of 202 citations for GDF 11 BMP 11 Human HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... Broad Range (11-245 kDa) (NEB P7712S) was loaded into an empty well.
-
bioRxiv - Synthetic Biology 2021Quote: ... Broad Range (11-250 kDa) (NEB #P7718). Native gel electrophoresis of intact VLPs was run on a 1% w/v agarose mini gel (7×7 cm ...
-
bioRxiv - Systems Biology 2020Quote: ... Broad Range (11-245 kDa) (New England Biolabs, #P7712S). Lysates were run in 1x Tris-Glycine (Thermo ...
-
bioRxiv - Genomics 2022Quote: ... 11 μL T4 DNA Ligase (400 U/μL, NEB), 2 μL RNase inhibitor (40 U/μL ...
-
bioRxiv - Developmental Biology 2019Quote: ... Blue pre-stained protein standard (11-190kDa) (New England Biolabs) was used ...
-
bioRxiv - Genomics 2020Quote: 11 μL T4 DNA ligase (400 U/μL, New England Biolabs),
-
bioRxiv - Molecular Biology 2019Quote: ... RNase digestion was stopped with 11 µl Murine RNase inhibitor (NEB) and insoluble material removed by centrifugation (15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein molecular ladder (Color Prestained Protein Standard, Broad Range 11–245 kDa, NEB, P7712S). Dry transfer was performed using an iBlot™ 2 gel transfer device (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... pCAGGS.SARS-CoV-2_SΔ19_fpl_mNG2(11)_opt was generated through gibson assembly (NEBuilder, New England Biolabs) of a pCAGGS vector backbone cleaved using EcoRV-HF and HindIII-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: pCAGGS.SARS-CoV-2_SΔ19_fpl_mNG2(11)_opt was generated using NEBuilder DNA assembly (New England Biolabs) of a pCAGGS vector backbone cleaved using EcoRV-HF and HindIII-HF (New England Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... 11 uL Exonuclease I Buffer and 2 uL Exonuclease I (New England Biolabs; M0293S) was added following reverse transcription and incubated at 37 °C for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were eluted from beads with 11 μl 1x TE and 1.5 μl USER enzyme (NEB) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were eluted from beads with 11 μl 1x TE and 1.5 μl USER enzyme (NEB) for 15 min at 37°C ...
-
bioRxiv - Biophysics 2022Quote: ... The DiCas7-11 mutants were prepared by Q5 2X master mix mutagenesis kit (New England Biolabs) using primers listed in Supplementary Table 2 and purified similarly as the wild-type DiCas7-11.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were eluted from beads with 11 μl 1x TE and 1.5 μl USER enzyme (NEB) for 15 min at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Cell Biology 2022Quote: ... with or without phosphatase addition (0.25 μL of 11 phosphatase in 50 μL reaction volume, New England Biolabs, P0753 or 200 nM purified 6xHis-Calcineurin ...
-
bioRxiv - Biochemistry 2021Quote: ... 11) with 15 cycles of PCR using NEBNext® Q5® Hot Start HiFi PCR Master Mix (NEB), which allowed to add Gap Repair recombination sequences for the cloning in Gal4-AD prey plasmid pP7 ...
-
bioRxiv - Immunology 2020Quote: ... and amplified by PCR for 11 cycles using NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using a PCR Purification Kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... and amplified by PCR for 11 cycles using NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using a PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... index groups and Illumina sequencing adapters were added by performing 11 PCR cycles with Phusion DNA Polymerase (NEB). We multiplexed the samples in several index groups (19 and 20 individuals each) ...
-
bioRxiv - Plant Biology 2023Quote: ... IP protocol described in (11) was followed thereafter and Epimark® N6-Methyladenosine Enrichment Kit (New England Biolabs) was used ...
-
bioRxiv - Developmental Biology 2021Quote: ... and PCR addition of indices (7-11 cycles) was done using NEBNext Ultra II DNA library prep kit (NEB). Biotinylated capture probes 70 nt in length were designed against every DpnII restriction fragment in a 2.5 Mb window centered on Runx1 (chr16:91,566,000-94,101,999) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were resuspended in 1 ml of iCLIP lysis buffer B (same as buffer A but with 1% v/v NP-40 and 11 μl of Murine RNase inhibitor (NEB) per 1 ml ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 1500-3000 bp of the 3’ coding sequence of each gene was amplified from RH genomic DNA and cloned into the pTKO2-HPT-3xHA plasmid (11) using either Gibson Assembly (NEB) or by cloning into the EcoRV and NotI restriction sites.
-
bioRxiv - Microbiology 2021Quote: ... and cloned to the C terminus of a 11 His-tagged maltose-binding protein in a pMAL-C5X vector (New England Biolabs) separated by a cleavage site for tobacco etch virus protease ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR amplification of transposon-genome junctions was performed using the cycling parameters described in the kit for 11 cycles with Q5 Ultra II FS Master Mix (NEB) using primers YL006 (AGCGGCAATTTCACACAGGA ...
-
bioRxiv - Microbiology 2023Quote: ... and JSW-SS-34:41 (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC) to amplify libraries for 11-13 cycles using Phusion High Fidelity PCR Master Mix (NEB) instead of the Illumina-supplied PCR reagents ...
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and the synthetic enhancers syn1–11 were cloned upstream of the 35S minimal promoter in pDL by Golden Gate cloning using BsaI-HFv2 (NEB). The synthetic enhancers were ordered as synthesized DNA fragments.
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was performed for 7-11 cycles (depending on input DNA concentration) using NEBNext Mulitplex Oligos (New England Biolabs). Indexed sample concentration was quantified using the KAPA Library Quantification Complete Kit (Universal)(Roche) ...
-
bioRxiv - Genomics 2022Quote: ... Proximity barcode ligations were carried out in 150 µl T4 ligation reaction mix (11 µL T4 ligase (NEB cat# M0437B-BM), 75 mM Tris pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 µL of ChIP DNA or about 400 ng of Input DNA were added to 70 µL of blunting mix (11 µL 10X NEBuffer 2 (NEB, B7002S), 0.5 µL 10 mg/mL BSA ...
-
bioRxiv - Genetics 2020Quote: ... PMO-induced alternative splicing of ush2a transcripts was analysed by PCR amplification using primers in zebrafish ush2a exon 11 using Q5 HF DNA polymerase (New England Biolabs, #M0491L). Primer sequences are provided in table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... Crude and purified proteins were further analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and its molecular weight (Broad range 11 to 245 kDa, BioLabs, England) was determined [14].
-
bioRxiv - Genomics 2021Quote: ... Tagmented DNA fragments were amplified by adding 12 µL PCR master mix composed of 11 µL Q5 High-Fidelity 2x Master Mix (New England Biolabs, #M0492) and 0.5 µL each of 10 mM Nextera i5 and i7 index primers ...
-
bioRxiv - Cell Biology 2021Quote: ... on a Mini Gel Tank (Thermo #A25977) using MES SDS Running Buffer (Thermo #B0002) alongside broad range markers (11-245KDa, NEB #P7712S). Each lane contained 20 μg of protein ...
-
bioRxiv - Immunology 2022Quote: ... Caspase-11 catalytic (C254A) and cleavage (D285A) mutants were generated by site-directed mutagenesis (Q5 SDM Kit, New England BioLabs; #E0554S) of the wild-type parent vector according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... which adds homology arms and YL_randBCs_R1_3’ which adds random 11 nt barcodes and downstream homology arms (NEB Q5 polymerase Tm=70C). The PCR product was pooled and cleaned using the Monarch PCR and DNA kit ...
-
bioRxiv - Genomics 2022Quote: ... Chimeric RNA barcode molecules were eluted from the bead by incubating with 127 µL ProK digestion solution (11 µL ProK (NEB cat # P8107B),100 mM Tris pH 7.5 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... vectors were from Park and Kim.11 The AtADT2 sequence and pHyo182 backbone were PCR-amplified and Gibson-assembled (NEB, Ipswich, MA). The S222N mutant of AtADT212 was recreated by site-directed mutagenesis (Q5® Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... SCAR-seq libraries were prepared following the previous published protocol (11) without any modification except using NEBNext® Ultra™ II DNA library prep kit (NEB) for the end repair ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were constructed using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina according to the protocol for ribosome depleted RNA and with a 11 min RNA fragmentation step (NEB - catalogue no. E7760). Library PCRs were supplemented with 2x SYBR dye (Sigma – catalogue no ...
-
bioRxiv - Cell Biology 2022Quote: ... Halt™ Protease and Phosphatase Inhibitor Cocktail in 1X PBS) and then washed twice with either 11 dephosphorylation buffer (1 mM MnCl2, 1X PMP buffer, New England Biolabs, P0753, protease inhibitors) or CN dephosphorylation buffer (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Microbiology 2022Quote: ... magnetosome genes were PCR amplified from the G2-11 genome using the high-fidelity Q5® polymerase (New England Biolabs, New England USA) and cloned by restriction sites into the pBamII-Tc vector (Supplementary Table S4) ...
-
bioRxiv - Molecular Biology 2023Quote: ... digoxigenin-11-ddUTP was added to the 3’ end of the digested fragments using terminal transferase enzyme (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Cell Biology 2023Quote: ... Mammalian cell lines were handled under sterile conditions using a laminar flow hood and the cells were regularly tested for mycoplasma contamination with a PCR-based mycoplasma detection kit (Minerva-Biolabs, cat.no. 11-1250). Subcultivation was performed every 2-4 days at a confluence of maximum 80 % using trypsin (Sigma-Aldrich ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...