Labshake search
Citations for New England Biolabs :
1 - 50 of 81 citations for Ebola Virus Envelope Glycoprotein GP Zaire Boende Lokolia since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... mutations were inserted into the open reading frame of Vesicular stomatitis virus glycoprotein VSV-G using the Q5 SDM kit (NEB). Myc epitope-tagged SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg standard glycoprotein was mixed in 1 μL of 10× glycoprotein denaturing buffer (NEB) (final conc ...
-
bioRxiv - Immunology 2020Quote: ... Platinum-GP cells (cell Biolabs, Inc) were transfected with a plasmid encoding the codon optimized SARS-COV-2 Spike gene from strain Wuhan-Hu-1 (GenBank ...
-
bioRxiv - Cell Biology 2020Quote: ... The time between nuclear envelope breakdown (NEB) and anaphase onset (AO ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μL of Glycoprotein denaturing buffer (NEB Cat # B0701S, 10X) and 4 μL water were mixed to a total of 10 μL ...
-
bioRxiv - Microbiology 2021Quote: ... cell lysates were mixed with glycoprotein denaturing buffer (New England Biolabs) and incubated at 100 °C for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... The lysates were sonicated and denatured with Glycoprotein Denaturing Buffer (NEB) by heating them at 100°C for 10 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 μg protein was mixed with 15 μL Glycoprotein Denaturing Buffer (NEB) in 150 μL total volume and incubated at room temperature for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... the isolated glycoproteins are treated by α-2,3/6/8 neuraminidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells undergoing mitosis were tracked from nuclear envelope breakdown (NEB) to anaphase onset ...
-
bioRxiv - Cell Biology 2022Quote: ... following the final wash proteins were eluted in Glycoprotein Denaturing Buffer (NEB, P0702S) for 10 mins at 100°C and then resuspended in EndoH (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Precipitated proteins were resuspended in 150 μL of Glycoprotein Denaturing Buffer (New England Biolabs) and incubated at 100 °C for 10 min ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate was denatured in glycoprotein-denaturing buffer and digested with PNGase (NEB P0704S) to remove N-linked glycoproteins ...
-
bioRxiv - Cell Biology 2020Quote: ... Mitotic duration was defined as the time from nuclear envelope breakdown (NEB) until division ...
-
bioRxiv - Cell Biology 2020Quote: ... Glycoprotein denaturation of the cell lysate was performed with 1x glycodenaturing buffer (New England Biolabs) at 95°C for 10 mins ...
-
bioRxiv - Cell Biology 2019Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB), which could be determined in our movies by adjusting the contrast to visualise when the cytoplasmic pool of the fluorescent protein was first observed to enter into the nucleus.
-
bioRxiv - Cell Biology 2022Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... The time taken for each cell to progress from nuclear envelope breakdown (NEB) to anaphase onset (chromatid separation ...
-
bioRxiv - Biochemistry 2021Quote: Native glycoproteins (10 μg) were digested with 1 U of IMPa (O-Glycoprotease, New England Biolabs) in 50 μL 20 mM Tris-HCl ...
-
bioRxiv - Immunology 2022Quote: HIV envelope plasmids were transformed and amplified in NEB-stable competent cells (NEB, C3040H). Pseudoviruses were produced by co-transfection of plasmids encoding various HIV-1 Envs together with NL4-3 ΔEnv or Q23-ΔEnv (1:3 ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Vaccinia virus Capping enzyme (NEB) and biotinylated RNA species were subsequently enriched by affinity purification using streptavidin beads yielding 0.6 to 1.3% of the sRNA preparation ...
-
bioRxiv - Cell Biology 2022Quote: Lysates (20 μg) and media immunoprecipitates were diluted to 10 μL in 2X glycoprotein denaturing buffer (NEB), and boiled for 10 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... N-linked glycans released from glycoproteins using Peptide:N-glycosidase F (PNGase F, New England Biolabs, Ipswich, MA) were mixed with 2,5-dihydroxybenzoic acid (DHB ...
-
bioRxiv - Developmental Biology 2024Quote: ... Once PCNA foci disappear the G2 phase starts and lasts until nuclear envelope breakdown (NEB). After apical mitosis ...
-
bioRxiv - Microbiology 2022Quote: ... 1-20 μg of the Env protein was mixed with 1 μl of Glycoprotein Denaturing Buffer (NEB, 10×) and H2O (if necessary ...
-
bioRxiv - Microbiology 2023Quote: ... The glycoprotein gene fragments and pCAGGS/MCS DNAs were ligated with Instant Sticky-End Ligase (New England Biolabs) and transformed into competent E ...
-
bioRxiv - Cell Biology 2023Quote: Equal amounts (25 μg) of whole normal muscle extracts were incubated with 1 x Glycoprotein denaturing buffer (Biolabs) at 100 °C for 10 min to denature glycoproteins ...
-
bioRxiv - Microbiology 2020Quote: ... or CatL-cleaved GPs were incubated with Protein N– glycosidase F (PNGaseF, 250U; New England Biolabs, Ipswich, MA) under reducing conditions for 16 h at 37℃to remove N–linked glycans ...
-
bioRxiv - Cell Biology 2020Quote: 100μg of each P13 and P40 sample was resuspended with 20μL of 1X glycoprotein denaturing buffer (New England BioLabs) and incubated at 100°C for 10 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercially available vaccinia virus capping system (NEB #M2080S) was used as a positive control.
-
bioRxiv - Biochemistry 2021Quote: ... coli or Expi293™ cells underwent denaturation at 95 °C for 10 min in glycoprotein denaturing buffer (New England Biolabs) followed by immediate cooling on ice for 10 s ...
-
bioRxiv - Cancer Biology 2023Quote: ... lysate volume equivalent to 20-40 µg total protein was first denatured at 100°C for 10 min in 1X glycoprotein denaturation buffer (NEB). Endo H digestion was performed at 37°C for 1h in the presence of 1X GlycoBuffer 3 and 1 µL of Endo H enzyme (NEB) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 40 – 50 µg of protein lysate from each sample was denatured in 1X Glycoprotein Denaturing Buffer (Cat.#B1704S; New England Biolabs) with 20 µL total volume at 100°C for 10 min ...
-
bioRxiv - Biochemistry 2019Quote: ... 37°C with vaccinia virus capping enzyme (New England Biolabs), as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and Moloney murine leukemia virus reverse transcriptase (New England Biolabs). Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... 20µg of protein lysates and media samples were incubated with glycoprotein denaturation buffer at 95°C for 10 min and treated with 0.3µl Endo H (NEB; Catalog no #P0702) enzyme in glyco-buffer 3 for one hour at 37°C ...
-
bioRxiv - Bioengineering 2019Quote: ... eukaryotic recombinant Stlac2 was denatured with Glycoprotein denaturing buffer at 100 °C for 10 min to be deglycosylated using PNGase F (NEB, USA) according to instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were first denatured with Glycoprotein Denaturing Buffer at 65°C for 15 min and then treated with Endoglycosidase H (Endo H) (New England Biolabs, #P0702S) or Peptide-N-Glycosidase F (PNGase F ...
-
bioRxiv - Cell Biology 2022Quote: ... only centriolar pairs that could be tracked from the beginning of nuclear cycle 12 until nuclear envelope breakdown (NEB) (for Sas-6)/beginning of nuclear cycle 13 (for Ana2)/throughout the entire detection window of the oscillation (for Plk4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Envelope gene mutations were introduced into WT cDNA sequence using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All cloned were sequenced (Eurofins).
-
bioRxiv - Zoology 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Evry, France) and random hexamer primers were used to transcribe 1 μg RNA in a 20 μl reaction into cDNA.
-
bioRxiv - Developmental Biology 2021Quote: ... All oligos were radioactively capped using Vaccinia virus capping system (NEB) and [α-32P]-GTP (Perkin-Elmer) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...
-
bioRxiv - Molecular Biology 2021Quote: All eight gene segments of the isolated H6N1 virus were amplified (NEB), purified (Omega ...
-
bioRxiv - Microbiology 2021Quote: ... Virus stocks were recovered following linearization of infectious clone plasmids using NotI-HF (NEB), in vitro transcription ...