Labshake search
Citations for New England Biolabs :
1 - 50 of 468 citations for Donkey Anti Goat IgG FITC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatants were immunoprecipitated overnight with 40 µL of precoated anti-IgG magnetic beads (goat anti-rabbit IgG magnetic beads, NEB) previously incubated with the antibody of interest for 4 h at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... before being incubated with alkaline phosphatase-labeled anti-rabbit IgG (New England Biolabs, Beverly, MA).
-
bioRxiv - Immunology 2021Quote: ... or an appropriate isotype-matched control (polyclonal goat isotype IgG, NEB) was added at a final concentration of 10 μg/ml and incubated overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... FHIP1B or FHIP2A-coated IgG beads were labeled with 5 µM HaloTag-Alexa-660 (New England Biolabs) in the column for 10 minutes at room temperature and unbound dye was removed with a 300 mL wash with TEV buffer at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-rabbit IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) or anti-mouse IgG (H+L ...
-
bioRxiv - Microbiology 2022Quote: ... goat polyclonal anti-UIS4 (LS Biolabs LS-C204260; IFA 1:1000); rabbit polyclonal anti-LISP2 (IFA ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sense and anti-sense digoxigenin labeled probes were then produced using Taq polymerase (New England Biolabs) and 40 cycles of PCR with either the sense or anti-sense primer in a Taq polymerase PCR mixture to which 0.067 mM of Digoxigenin-5-aminoallyl-dUTP (Jena Bioscience GmbH ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-mouse IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) were used as the secondary antibodies.
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... was detected by addition of 1 nM Europium-labeled anti-p53 phosphoserine 15 antibody (New England Biolabs/ Cisbio) and 40 nM streptavidin-conjugated APC (Prozyme ...
-
bioRxiv - Microbiology 2021Quote: ... or radio-labeled Msp1-digested pBR322 (NEB). Membranes were hybridized with complementary RNA probes ...
-
bioRxiv - Plant Biology 2019Quote: ... Lysates pre-cleared for 15 minutes with 50µl goat anti-rabbit magnetic beads (NEB). Pre-cleared lysates were then incubated with either goat anti-rabbit magnetic beads only (mock IP ...
-
bioRxiv - Microbiology 2019Quote: ... followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
bioRxiv - Biophysics 2022Quote: Open complexes were pre-formed by incubating an excess of RNAP holoenzyme (>1.7 nM active) with <400 pM γ-32P-labeled promoter DNA (labeled with T4 polynucleotide kinase from NEB) in BB at 37 °C for at least 30 min ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Cell Biology 2021Quote: ... radioactively labeled using Klenow fragment (New England Biolabs) and [α-32P]dCTP ...
-
bioRxiv - Microbiology 2022Quote: ... and end- labeled using T4 polynucleotide kinase (NEB) with [γ-32P] ATP (Perkin Elmer) ...
-
bioRxiv - Genomics 2019Quote: ... labeled DNA was repaired with Taq ligase (NEB) at 37 °C for 30 min to restore integrated double strands DNA ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... Probe was labeled with T4 PNK (NEB M0201S) at 37°C for 1 h in a reaction containing 20 pmol probe ...
-
bioRxiv - Bioengineering 2021Quote: ... Antibodies used for targeted depletion were prepared using goat anti-rabbit magnetic beads (NEB, S1432S) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... the membrane was incubated with HRP-conjugated secondary antibody (goat anti-rabbit HRP, BioLabs 7074P2) in 3% BSA in PBS-T shaking for 1-2 h at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA Probes were labeled with DIG (New England Biolabs) or DNP-11-UTP (Perkin Elmer ...
-
bioRxiv - Genomics 2020Quote: ... Biotin labeled dATP (Thermo,19524016) and Klenow (NEB, M0210) were used to fill restriction fragment overhangs ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... the FLAG eluate was labeled with SNAP-Surface549 (NEB) by incubating 3x molar excess of dye at 4°C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5’ end-labeled using T4 polynucleotide kinase (NEB) and [γ-32P] ATP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1M cells were labeled with SNAP-Surface 647 (NEB) following manufacturer’s recommendation (50 μM concentration of SNAP-Surface 647 in complete cell media ...
-
bioRxiv - Developmental Biology 2023Quote: ... and end-labeled using T4 polynucleotide kinase (M0201, NEB) and [γ-32P] ATP (NEG002A250UC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Genomics 2019Quote: ... and labeled using the enzyme Nt.BspQI (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genomics 2019Quote: ... and labeled using the enzyme Nt.BspQI (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2019Quote: ... cells were labeled with CLIP-Surface 547 (NEB, catalog S9233S) and SNAP-Surface Alexa Fluor 647 (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Telomere probe was labeled using T4 polynucleotide kinase (NEB M0201) and <ι>γ-P32-ATP (Perkin Elmer NEG035C ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were pulse-labeled with SNAPcell-505 (1 µM; NEB) for 20 min in media ...
-
bioRxiv - Biochemistry 2022Quote: ... and labeled with [γ-32P]ATP by T4 PNK (NEB), followed by gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... and 7SK (GTGTCTGGAGTCTTGGAAGC) were radioactively labeled using T4 PNK (NEB) and ∼10x106 cpm of each probe were added to the membrane ...
-
bioRxiv - Microbiology 2019Quote: ... overnight at 4°C followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Northern probes were labeled with 32P ATP with T4 PNK (NEB), purified with a G25 column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2021Quote: ... and labeled with SNAP-Cell TMR-Star (New England Biolabs, S9105S) or SNAP-Cell 647-SiR (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was labeled with gamma-32P-ATP using T4 PNK (NEB). After washing with PNK buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The probes were labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32P] ATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The labeled oligonucleotide (∼5 pmol) was treated with uracil glycosylase (NEB) in 1x UDG buffer (20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: ... the substrates used are 5’-end-labeled with T4 PNK (NEB) in the presence of gamma 32P-ATP ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were labeled with Oregon-Green SNAP substrate (New England Biolabs) at 4 µM final concentration for labeling of the newly synthesized CENP-A molecules ...
-
bioRxiv - Molecular Biology 2019Quote: Atto647N-labeled target DNA was generated with Q5 DNA polymerase (NEB) using oligonucleotides 365 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Northern probes were labeled with 32P ATP with T4 PNK (NEB) and purified with a G25 column (GE healthcare) ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Cell Biology 2019Quote: ... Shi-SNAP was labeled fluorescently with SNAP-Surface 488 (New England Biolabs), and Shi-SNAP-Surface 488-mediated actin bundles were visualized by TIRF imaging ...