Labshake search
Citations for New England Biolabs :
1 - 50 of 2085 citations for Dengue Virus Serotype 3 NS1 Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The JEV NS1 gene was PCR-amplified with Deep Vent polymerase (New England Biolabs) using forward primer OSV 389 and sequential reverse primers OSV 381 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE, NEB) in the presence of GTP and S-adenosylmethionine (SAM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... insertion of GLuc and chimera of CBD were introduced into the flavivirus NS1 constructs (DENV, ZIKV, YFV) using Q5® Site-Directed Mutagenesis Kit (NEB) used according manufacturer’s instructions.
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Vaccinia virus Capping enzyme (NEB) and biotinylated RNA species were subsequently enriched by affinity purification using streptavidin beads yielding 0.6 to 1.3% of the sRNA preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AAV transfer vectors used for 3-plex sgRNA delivery into skeletal muscle were cloned between AAV serotype 2 ITR’s including a cloning site for multiplexed hU6-sgRNA insertions (MluI and KpnI (NEB)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercially available vaccinia virus capping system (NEB #M2080S) was used as a positive control.
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 DNA was extracted and amplified by Q5 High-Fidelity PCR (NEB, M0494S) using primers encompassing the sgRNA recognition site ...
-
bioRxiv - Biochemistry 2019Quote: ... 37°C with vaccinia virus capping enzyme (New England Biolabs), as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and Moloney murine leukemia virus reverse transcriptase (New England Biolabs). Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... The bead-bound protein was incubated with 3 µM SNAP-Surface Alexa Fluor 647 (NEB) for 40-60 min at 4°C (to fluorescently label the protein) ...
-
bioRxiv - Zoology 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Evry, France) and random hexamer primers were used to transcribe 1 μg RNA in a 20 μl reaction into cDNA.
-
bioRxiv - Developmental Biology 2021Quote: ... All oligos were radioactively capped using Vaccinia virus capping system (NEB) and [α-32P]-GTP (Perkin-Elmer) ...
-
bioRxiv - Molecular Biology 2021Quote: All eight gene segments of the isolated H6N1 virus were amplified (NEB), purified (Omega ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of genomic DNA was incubated with 3 µg of in vitro transcribed sgRNAs and 3 µg of purified Cas9 protein in 20µl of 1x NEB3 buffer (New England Biolabs) at 37°C over night ...
-
bioRxiv - Microbiology 2024Quote: ... protein aliquots were subjected to PNGase F or a broad range mannosidase (α1,2/3/6) (New England Biolabs, France) digestion according to the manufacturer’s specifications ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.5 µL of 10X GlycoBuffer 3 (Cat.#B1720S; New England Biolabs) and 2.5 µL of Endo Hf in a total reaction volume of 25 µL ...
-
bioRxiv - Microbiology 2021Quote: ... Virus stocks were recovered following linearization of infectious clone plasmids using NotI-HF (NEB), in vitro transcription ...
-
bioRxiv - Microbiology 2022Quote: ... The virus lysate was then denatured by boiling in denaturing buffer (New England BioLabs) for 10 min and treated with PNGase F or Endo Hf enzymes (New England BioLabs ...
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs). Regularly ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Cat. #E7770) or NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (#E7760) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Dephosphorylated RNA-protein complexes were then rinsed once with NT2 buffer and 3’-end ligated with T4 RNA Ligase 1 (NEB) overnight in an Eppendorf Thermomixer at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... To visualize SNAP-tagged dCENP-A proteins cells were labelled with 3 µM SNAP-Cell TMR Star (New England Biolabs) for 30 min ...
-
Suppressing STAT3 activity protects the endothelial barrier from VEGF-mediated vascular permeabilitybioRxiv - Molecular Biology 2020Quote: ... to a final concentration of 0.1µg/ml was incubated with 3 µg purified STAT3 proteins as well as 5 µl ATP (New England Biolabs; N0440S) for 30 minutes at 30°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Virus stocks were generated by either transfecting purified in vitro transcribed viral RNA (HiScribe, NEB) or transfecting the infectious cDNA clone containing plasmid in BHK-T7 cells ...
-
bioRxiv - Biochemistry 2023Quote: Infection in HCT116: Cells were infected with virus and 8 μg/mL polybrene (NEB, #H9268).
-
bioRxiv - Cell Biology 2024Quote: ... RNA was reverse transcribed with Moloney murine leukemia virus (M-MuLV) transcriptase (New England Biolabs). The purity and concentration of RNA were measured using NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Synthetic Biology 2021Quote: 8.3 μM bdSUMO-HSPB611–20 fusion protein containing pSer or nhpSer at site S16 of HSPB6 were reacted with 3 units of λ phosphatase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... cell and virus particle lysates were treated with PNGase F and Endo Hf (New England Biolabs) following the manufacturer’s protocol for 1 hour at 37°C prior to Western blotting.
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...