Labshake search
Citations for New England Biolabs :
1 - 50 of 87 citations for DSPE PEG 2000 Amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... 20% PEG-8000 (NEB)) ...
-
bioRxiv - Genomics 2019Quote: ... 5μL PEG 8000 (NEB), 1μL SR RT Primer and following the manufacturers protocol (NEB small RNA for Illumina library prep) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4µl 50% PEG 8000 (NEB), 0.1µl 10mM ATP ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μl 50% PEG 8000 (NEB), 1 μl 40 U/μl−1 RNase Inhibitor (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl 50% PEG 8000 (NEB), 1.3 μl T4 RNA ligase (30 U/µl ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 µl of 1 mM BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 µl of axonemes ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µl of 1 mM BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 µl of axonemes ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl 50% PEG 8000 (NEB, M0242), 1 μl 40 U μl-1 RNase Inhibitor (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 25% (w/v) PEG-8000 (NEB) with 600U of T4 Rnl2tr K227Q (homemade ...
-
bioRxiv - Plant Biology 2023Quote: ... point or deletion mutants of pGH-dspE was obtained using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) with following primer sets:
-
bioRxiv - Cell Biology 2019Quote: ... 1 μl of 1 mM BG-biotin or BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 μl of the purified axonemes in HMEEK buffer and incubated overnight at 4 °C ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 50% PEG-800 (New England Biolabs), 4 μl 10× T4 RNA ligase buffer (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... containing 25% v/v PEG 8000 (NEB, #B1004) and 20% v/v acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... 6 μl of 50% PEG 8000 (NEB B1004A), 40 units of Ribolock RNase inhibitor EO0382)] ...
-
bioRxiv - Genomics 2021Quote: ... prepared by drying 50% PEG 8000 (New England Biolabs) in PCR tubes in a SpeedVac at 35° C for 2 hours.
-
bioRxiv - Genomics 2019Quote: ... 1 μL PEG 8000 (New England Biolabs; 50% stock), 2 μL 5X RT Buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μl of 50% PEG 8,000 (New England Biolabs), 1 μl of iTP_3’_linker_ApoI (10 μM ...
-
bioRxiv - Microbiology 2024Quote: ... and 5% v/v PEG 8000 (New England Biolabs) during ligation.
-
bioRxiv - Biophysics 2023Quote: ... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... PEG 8000 (17.5% final) and T4 RNA ligase 2 (NEB) in 1x T4 RNA ligase buffer at 25°C for 1 h ...
-
bioRxiv - Genomics 2020Quote: ... Ligation Master Mix (9μL 50% PEG 8000, 2μL 10x NEB T4 RNA Ligase Buffer ...
-
bioRxiv - Immunology 2023Quote: ... and 10 μL of PEG 8000 50% (NEB, cat. no: M0204S). The ligation mix was then incubated for at least 18 hours up to a maximum of 23 hours at 16 °C and then heat inactivated at 65 °C for 10 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-rabbit IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) or anti-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-mouse IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) were used as the secondary antibodies.
-
bioRxiv - Biochemistry 2023Quote: ... T7 RNAP@BG or T7 RNAP@PEG in RNA polymerase buffer (New England Biolabs). For reaction time courses ...
-
bioRxiv - Biochemistry 2021Quote: ... The alkyne-PAR was purified to remove excess alkyne-PEG1-amine using the Monarch Nucleic Acid Cleanup Kit (NEB) following the recommended protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... in the presence of a final concentration of 10% PEG-8000 (New England Biolabs, B1004), in a total volume of 12 μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ligation was performed in 25% PEG 8000 (61) by T4 RNA Ligase 2 Truncated K227Q (NEB) for 8 h at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 mL ERA reaction (13 T4 DNA ligase buffer [NEB], 0.5 mM dNTPs, 0.25 mM ATP, 2.75% PEG 4000, 6U T4 PNK [NEB] ...
-
bioRxiv - Genomics 2020Quote: ... The sample was then combined with 3’ RNA Ligase Master Mix (8μL 50% PEG 8000, 2μL 10x T4 RNA Ligase Buffer (B0216L, NEB), 1.5μL nuclease free water ...
-
bioRxiv - Bioengineering 2020Quote: ... T4 DNA ligase (2000 units, NEB) was added and the mixture was incubated at room temperature overnight ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Table S2.1) for hydrogel functionalisation were synthesised by mixing one volume of 40 mM BG-PEG-NH2 (NEB S9150S) or 40 mM chloroalkane-PEG-NH2 (Promega P6741 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 2000 U T4 DNA Ligase (NEB) in 1x T4 DNA Ligase buffer (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Both 3' and 5' ligations were carried out with degenerate adaptors (each containing 4 random nucleotides) in the presence of 10% Polyethylene Glycol (PEG 8000, NEB) and 0.5 μL of Superasin (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: 3’-dT-tailed barcode cassettes were ligated into a 3’-dA-tailed vector and the DNA circularized using T4 DNA Ligase in a PEG-6000 containing buffer (Quick Ligation Buffer, NEB). Ligation was performed at a 30:1 insert:vector molar ratio at bench temperature (24°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were placed on ice and Ligation Master Mix (1x NEB Ligase Buffer, 1mM ATP, 25% PEG 8000, 15U T4 RNA Ligase I (NEB)) was added to samples ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Table S3 ...
-
bioRxiv - Microbiology 2023Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Systems Biology 2020Quote: ... 10 mM DTT, 12% PEG 8000, 1 mM each dNTPs, 10 µM dN-SMRT oligo, 5 µl Klenow enzyme NEB #M0212) for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and micrococcal nuclease (stock 2000 U/μL, NEB). 6* protein loading sample buffer without DTT or SDS was added to samples before loading into a precast native 4-12% tris glycine gel (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... and 2000 U T4 DNA ligase (NEB M0202M) was added ...
-
bioRxiv - Microbiology 2023Quote: ... and Micrococcal nuclease (2000 U, New England Biolabs) to digest remaining free-floating eukaryotic and bacterial nucleic acids ...
-
bioRxiv - Cell Biology 2020Quote: ... 2000 ligation units of T4 DNA ligase (NEB, M0202), and 30 units of T7 DNA polymerase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... A DNase I RNAse free 2000 U/ml (NEB) treatment was done using 1 μl for 15 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer, 2 µM oBZ407_preA preadenylated linker, 100 units NEB T4 RNA ligase 2, truncated) and they were further incubated at 37 °C for 3 hrs ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were split in half for MNase (2000 units, NEB) treatment at 27°C for 30 min or mock treatment on ice ...