Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Cyclic GMP Direct ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... purified KRAS protein was mixed with GMP-PNP (molar ratio of 10:1 GMP-PNP:KRAS) and calf intestinal alkaline phosphatase (NEB cat# M0290, 3 units per mg of KRAS). The reaction mixture was incubated for 3 hours at room temperature and then purified by size-exclusion chromatography on a 10/300 Superdex 75 GL column (GE Healthcare ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or direct mutagenesis (Q5® Site-Directed Mutagenesis Kit, NEB) and cloned into the retroviral expression vector pQCXIZ by either restriction digestion and ligation ...
-
bioRxiv - Biochemistry 2023Quote: ... GST-tag HP1⍺ΔC construct was generated by site-direct mutagenesis kit (NEB) by deleting the amino acids (number 169 –181 ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Dephosphorylation of cyclic phosphate groups were carried out with T4 PNK (10 U/uL, M0201, NEB) in a low pH buffer (5X PNK pH 6.5 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Dephosphorylation of cyclic phosphate groups was carried out with T4 PNK (10 U/µL, M0201, NEB) in a low pH buffer (25 mM MES (2-(N-morpholino)ethanesulfonic acid) ...
-
bioRxiv - Biochemistry 2024Quote: ... All individual PLpro mutations were introduced into pDONR221-PLpro using NEB Q5 Site-Direct Mutagenesis Kit (NEB) following manufacturer’s instructions and shuttled into FU-tetO-Gateway-rtTA-2A-Puro using LR clonase.
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding various dSARM1ARM mutants were generated using the Q5® Site-Direct Mutagenesis Kit (New England BioLabs). Plasmids were transformed into BL21 (DE3 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Biophysics 2022Quote: ... This construction was used as a template to introduce the mutation W330A using the Q5-Site Direct Mutagenesis Kit (NEB) with the oligonucleotides W330A-fw 5′-GAGCGGTACCGCCCTGACCTATACCG- and W330A-rv 5′-GGGGTAACTTCCATGCCA- ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... and UBA domain (L309D, M332K/Y334F, and ΔYFLLL) mutants were generated using Q5 Hot Start Site Direct Mutagenesis kit (New England BioLabs, E0552S). BRSK2 domain deletion mutations ΔN (Δ kinase) ...
-
bioRxiv - Microbiology 2021Quote: E248R deletion mutant proteins of distinct domains (Δ constructs) were generated from E248R WT plasmid by site direct mutagenesis using the Q5 mutagenesis kit (New England Biolabs) as follows ...
-
bioRxiv - Genetics 2019Quote: ... RNA was isolated from cells using the Direct-zol™ RNA Miniprep Kit and used to generate cDNA (Protoscript II, NEB). Protein was isolated from cells as described above.
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutations were introduced into the ATP11A ORF using a The Q5® Sit-direct mutagenesis kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2022Quote: ... These linearized templates were used to direct in vitro transcription (IVT) of mRNAs using the HiScribe™T7 mRNA Kit with CleanCap® Reagent AG (NEB). Cy3-UTP and Cy5-UTP were used replacing 25% of standard UTP in some experiments to fluorescently label the mRNA transcripts ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit) followed by a 1 h incubation at 25°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NNN spacer to increase library diversity during sequencing (preadenylated oligos were prepared by 5’ DNA adenylation kit (E2610L) using thermostable 5’ App DNA/RNA ligase (M0319L, both from New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Molecular Biology 2020Quote: This oligonucleotide was adenylated using the 5’ DNA adenylation kit (NEB, E2610S) as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Molecular Biology 2019Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Biophysics 2020Quote: We used in vitro mutagenesis (Q-5 Site-directed Mutagenesis Kit, NEB) to introduce the mutations creating d isoforms using the following primers ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligas’ 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.6 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 15% PEG ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...