Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Cyclic GMP Direct Chemiluminescent ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... purified KRAS protein was mixed with GMP-PNP (molar ratio of 10:1 GMP-PNP:KRAS) and calf intestinal alkaline phosphatase (NEB cat# M0290, 3 units per mg of KRAS). The reaction mixture was incubated for 3 hours at room temperature and then purified by size-exclusion chromatography on a 10/300 Superdex 75 GL column (GE Healthcare ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or direct mutagenesis (Q5® Site-Directed Mutagenesis Kit, NEB) and cloned into the retroviral expression vector pQCXIZ by either restriction digestion and ligation ...
-
bioRxiv - Biochemistry 2023Quote: ... GST-tag HP1⍺ΔC construct was generated by site-direct mutagenesis kit (NEB) by deleting the amino acids (number 169 –181 ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Dephosphorylation of cyclic phosphate groups were carried out with T4 PNK (10 U/uL, M0201, NEB) in a low pH buffer (5X PNK pH 6.5 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Dephosphorylation of cyclic phosphate groups was carried out with T4 PNK (10 U/µL, M0201, NEB) in a low pH buffer (25 mM MES (2-(N-morpholino)ethanesulfonic acid) ...
-
bioRxiv - Biochemistry 2024Quote: ... All individual PLpro mutations were introduced into pDONR221-PLpro using NEB Q5 Site-Direct Mutagenesis Kit (NEB) following manufacturer’s instructions and shuttled into FU-tetO-Gateway-rtTA-2A-Puro using LR clonase.
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding various dSARM1ARM mutants were generated using the Q5® Site-Direct Mutagenesis Kit (New England BioLabs). Plasmids were transformed into BL21 (DE3 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Biophysics 2022Quote: ... This construction was used as a template to introduce the mutation W330A using the Q5-Site Direct Mutagenesis Kit (NEB) with the oligonucleotides W330A-fw 5′-GAGCGGTACCGCCCTGACCTATACCG- and W330A-rv 5′-GGGGTAACTTCCATGCCA- ...
-
bioRxiv - Cell Biology 2019Quote: ... and UBA domain (L309D, M332K/Y334F, and ΔYFLLL) mutants were generated using Q5 Hot Start Site Direct Mutagenesis kit (New England BioLabs, E0552S). BRSK2 domain deletion mutations ΔN (Δ kinase) ...
-
bioRxiv - Microbiology 2021Quote: E248R deletion mutant proteins of distinct domains (Δ constructs) were generated from E248R WT plasmid by site direct mutagenesis using the Q5 mutagenesis kit (New England Biolabs) as follows ...
-
bioRxiv - Genetics 2019Quote: ... RNA was isolated from cells using the Direct-zol™ RNA Miniprep Kit and used to generate cDNA (Protoscript II, NEB). Protein was isolated from cells as described above.
-
bioRxiv - Biochemistry 2020Quote: ... Mutations were introduced into the ATP11A ORF using a The Q5® Sit-direct mutagenesis kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2022Quote: ... These linearized templates were used to direct in vitro transcription (IVT) of mRNAs using the HiScribe™T7 mRNA Kit with CleanCap® Reagent AG (NEB). Cy3-UTP and Cy5-UTP were used replacing 25% of standard UTP in some experiments to fluorescently label the mRNA transcripts ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Microbiology 2022Quote: RNAs for direct cDNA sequencing were treated with T4 Polynucleotide Kinase (NEB, M0201) following the manufacturer’s non-radioactive phosphorylation protocol ...
-
bioRxiv - Genomics 2020Quote: ... Cells from single wells were screened via direct lysis by proteinase K (P8107S; NEB) in 20 μl of single cell lysis buffer (10 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Synonymous mutations in the DBT cDNA were generated with Q5-site direct mutagenesis (NEB, E0554S) by replacing CACTTCCTGAAAACAACTGC with CATTTTTTAAAGACGACCGC in exon 1 ...
-
CCG•CGG interruptions in high penetrance SCA8 families increase RAN translation and protein toxicitybioRxiv - Genetics 2021Quote: ... Expansions too large for direct sequence (approximately >250 repeats) were digested with MspA1I (New England Biolabs) which ambiguously digests the PCR products containing either CGG or CTG interruptions in the CAG direction of the repeat tract ...
-
bioRxiv - Genomics 2021Quote: ... into 96-well plate containing 2.5μl of methylase reaction buffer (1 × M.CviPI Reaction buffer (NEB), 2 U M.CviPI (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 μM Illumina barcode (NEB-kit) to 23 μl of cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... We used direct ligation of an RNA adapter to the harvested RNA after initial dephosphorylation(NEB Antartic Phosphatase) of free ends ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: mRNA was isolated from 6-well plates showing a cell confluency of ∼90% using the Monarch Total RNA Miniprep kit (NEB). siRNA transfection was performed 48 hours prior to RNA isolation using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... and direct gene synthesis (from Integrated DNA Technologies) and were assembled using Gibson or HiFi Assembly (New England BioLabs) unless otherwise stated ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 uL BsmbI-v2 Golden Gate Assembly Kit (NEB E1602L), and 15.03 uL nuclease free H2O ...
-
bioRxiv - Genetics 2024Quote: ... Genome PCR products which were confirmed as a single band in AGE were subjected to direct Sanger sequencing after decomposing remaining nucleotides and primers by the treatment with 2U Exonuclease I (NEB) and 0.1U Shrimp Alkaline Phosphatase (NEB).
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Molecular Biology 2020Quote: ... including uracil with compatible USER sites easing direct cloning into linearized and nicked pUSER016 vector by USER cloning (USER®, NEB), resulting in plasmid pUSER016-pT7-MglE.
-
bioRxiv - Immunology 2020Quote: ... For genotyping hair samples were incubated in 250 μL of Direct PCR reagent and 20 mg/mL Proteinase K (New England Biolabs, P8102) for 1 h at 55°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... All the pieces necessary for genome editing via Homology Direct Repair (HDR) were inserted via NEBuilder HiFi DNA Assembly Master Mix (NEB #2621) into a plasmid with a negative selection marker that can be used to screen against integration of the entire plasmid into the genome ...
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Neuroscience 2023Quote: ... column purified and ligated at a 1:1 vector to insert ratio using the QuickLig Kit (NEB #M2200S). The ASCL1 stop codon was subsequently mutated using the QuickChange II-XL site-directed mutagenesis kit (Agilent #200523 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µg RNA was reverse transcribed using LunaScript RT SuperMix Kit (NEB). qPCR was performed using synthesised cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... samples were pooled by plate and ExonucleaseI (NEB) digestion was performed ...
-
bioRxiv - Immunology 2023Quote: All PD-1 mutants were generated using Q5 site-directed mutagenesis kit (NEB) following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was first circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...