Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Cyclic AMP Direct ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: Long Amp Taq Polymerase (New England Biolabs) was used to PCR amplify Plasmid DNA after sort 4 according to manufacturer’s protocol with the following primers:
-
bioRxiv - Microbiology 2020Quote: ... 1x Long Amp Taq Reaction Buffer (NEB), 0.4 mM dNTPs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reactions were undertaken in 25 ul consisting of 1 x Long amp Taq buffer (NEB), 300 μM dNTP mix ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or direct mutagenesis (Q5® Site-Directed Mutagenesis Kit, NEB) and cloned into the retroviral expression vector pQCXIZ by either restriction digestion and ligation ...
-
bioRxiv - Microbiology 2021Quote: p15a-SceIdeg-amp was cloned using HiFi DNA Assembly (NEB) by fusing two PCR fragments ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 U Long Amp Hot Start Taq DNA Polymerase (NEB) and 156 ng DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl cDNA reaction mix was amplified by adding 25 μl of Long Amp Taq 2x Master Mix (NEB-kit), 1.25 μl SR primer for Illumina (NEB-kit) ...
-
bioRxiv - Molecular Biology 2020Quote: ... ampicillin resistance gene (Amp) was derived from pUC19 (New England Biolabs) whereas gene expression cassette were amplified from and pET30a (Novagen ...
-
bioRxiv - Biochemistry 2023Quote: ... GST-tag HP1⍺ΔC construct was generated by site-direct mutagenesis kit (NEB) by deleting the amino acids (number 169 –181 ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... were cloned into pTwist-Amp (Twist Bioscience) using Golden Gate Assembly (NEB). pMK232 was a gift from Masato Kanemaki (Addgene plasmid # 72834 ...
-
bioRxiv - Biochemistry 2022Quote: ... the empty pE-SUMOpro Amp vector was cut using BsaI enzyme (NEB). ORFs were amplified with primers that added 5’-CGCGAACAGATTGGAGGT-3’ upstream of the start of the ORF ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Dephosphorylation of cyclic phosphate groups were carried out with T4 PNK (10 U/uL, M0201, NEB) in a low pH buffer (5X PNK pH 6.5 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Dephosphorylation of cyclic phosphate groups was carried out with T4 PNK (10 U/µL, M0201, NEB) in a low pH buffer (25 mM MES (2-(N-morpholino)ethanesulfonic acid) ...
-
bioRxiv - Immunology 2021Quote: ... in YPD supplemented with 100 µg/ml ampicillin and 1% glucose (YPD-Amp-Glu) were infected with M13KO7 helper phage (New England Biolabs, USA) at 7×109 plaque forming unit (PFU ...
-
bioRxiv - Biochemistry 2024Quote: ... All individual PLpro mutations were introduced into pDONR221-PLpro using NEB Q5 Site-Direct Mutagenesis Kit (NEB) following manufacturer’s instructions and shuttled into FU-tetO-Gateway-rtTA-2A-Puro using LR clonase.
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding various dSARM1ARM mutants were generated using the Q5® Site-Direct Mutagenesis Kit (New England BioLabs). Plasmids were transformed into BL21 (DE3 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Pathology 2021Quote: ... These clones were further analyzed by genomic PCR using Long Amp Taq DNA polymerase (New England Biolabs) to check the downstream inserted sequence ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene-specific LA-qPCR assays for measuring DNA strand-breaks (SBs) were performed as described earlier (7,17,18,22) using Long Amp Taq DNA Polymerase (New England BioLabs). 10 ng of genomic DNA was used as a template to amplify transcribed genes (10.4 kb region of the hypoxanthine-guanine phosphoribosyltransferase [HPRT] ...
-
bioRxiv - Biochemistry 2023Quote: ... in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described earlier18,19,41,42 using Long Amp Taq DNA Polymerase (New England BioLabs). Three transcribed (HPRT ...
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Biophysics 2022Quote: ... This construction was used as a template to introduce the mutation W330A using the Q5-Site Direct Mutagenesis Kit (NEB) with the oligonucleotides W330A-fw 5′-GAGCGGTACCGCCCTGACCTATACCG- and W330A-rv 5′-GGGGTAACTTCCATGCCA- ...
-
bioRxiv - Cell Biology 2019Quote: ... and UBA domain (L309D, M332K/Y334F, and ΔYFLLL) mutants were generated using Q5 Hot Start Site Direct Mutagenesis kit (New England BioLabs, E0552S). BRSK2 domain deletion mutations ΔN (Δ kinase) ...
-
bioRxiv - Microbiology 2021Quote: E248R deletion mutant proteins of distinct domains (Δ constructs) were generated from E248R WT plasmid by site direct mutagenesis using the Q5 mutagenesis kit (New England Biolabs) as follows ...
-
bioRxiv - Genetics 2019Quote: ... RNA was isolated from cells using the Direct-zol™ RNA Miniprep Kit and used to generate cDNA (Protoscript II, NEB). Protein was isolated from cells as described above.
-
bioRxiv - Biochemistry 2020Quote: ... Mutations were introduced into the ATP11A ORF using a The Q5® Sit-direct mutagenesis kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2022Quote: ... These linearized templates were used to direct in vitro transcription (IVT) of mRNAs using the HiScribe™T7 mRNA Kit with CleanCap® Reagent AG (NEB). Cy3-UTP and Cy5-UTP were used replacing 25% of standard UTP in some experiments to fluorescently label the mRNA transcripts ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products digested by SphI and HindIII were cloned into pQF50-chl and/or pQF50-Amp plasmids using T4 DNA ligase (NEB) to generate the different pMP plasmids (38 ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
bioRxiv - Synthetic Biology 2022Quote: A double-stranded DNA scaffold template was obtained from pUCIDT-AMP-T7p_DB982 plasmid (10 ng in 50 μL reaction mixture) by PCR amplification using Phusion® DNA polymerase (NEB), T7-DB982 forward and T7-DB982 reverse primers (0.5 μM each) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNA was synthesized from each of these PCR products in the presence of a 50-fold molar excess of AMP over ATP (74) with T7 RNA polymerase (NEB M0251). Each 50 μL reaction contained 1X reaction buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting products were pre-amplified in a 100 μL reaction using 10 cycles with 4 μL pre-amp primers (10x Genomics PN 20002714) and 50 μL of NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S). Reactions were cleaned with 1.6X SPRI and eluted in 40 μL EB ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Cancer Biology 2021Quote: ... Gene-specific LA-qPCR analyses for measuring DNA damage were performed using Long Amp Taq DNA polymerase (New England Biolabs, Cat no MO323S). Since amplification of a small region would be independent of DNA damage ...
-
bioRxiv - Microbiology 2022Quote: RNAs for direct cDNA sequencing were treated with T4 Polynucleotide Kinase (NEB, M0201) following the manufacturer’s non-radioactive phosphorylation protocol ...
-
bioRxiv - Genomics 2020Quote: ... Cells from single wells were screened via direct lysis by proteinase K (P8107S; NEB) in 20 μl of single cell lysis buffer (10 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Synonymous mutations in the DBT cDNA were generated with Q5-site direct mutagenesis (NEB, E0554S) by replacing CACTTCCTGAAAACAACTGC with CATTTTTTAAAGACGACCGC in exon 1 ...
-
CCG•CGG interruptions in high penetrance SCA8 families increase RAN translation and protein toxicitybioRxiv - Genetics 2021Quote: ... Expansions too large for direct sequence (approximately >250 repeats) were digested with MspA1I (New England Biolabs) which ambiguously digests the PCR products containing either CGG or CTG interruptions in the CAG direction of the repeat tract ...
-
bioRxiv - Genomics 2021Quote: ... into 96-well plate containing 2.5μl of methylase reaction buffer (1 × M.CviPI Reaction buffer (NEB), 2 U M.CviPI (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 μM Illumina barcode (NEB-kit) to 23 μl of cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... We used direct ligation of an RNA adapter to the harvested RNA after initial dephosphorylation(NEB Antartic Phosphatase) of free ends ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...