Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Cyclic AMP Direct Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: Long Amp Taq Polymerase (New England Biolabs) was used to PCR amplify Plasmid DNA after sort 4 according to manufacturer’s protocol with the following primers:
-
bioRxiv - Microbiology 2020Quote: ... 1x Long Amp Taq Reaction Buffer (NEB), 0.4 mM dNTPs ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or direct mutagenesis (Q5® Site-Directed Mutagenesis Kit, NEB) and cloned into the retroviral expression vector pQCXIZ by either restriction digestion and ligation ...
-
bioRxiv - Microbiology 2021Quote: p15a-SceIdeg-amp was cloned using HiFi DNA Assembly (NEB) by fusing two PCR fragments ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 U Long Amp Hot Start Taq DNA Polymerase (NEB) and 156 ng DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl cDNA reaction mix was amplified by adding 25 μl of Long Amp Taq 2x Master Mix (NEB-kit), 1.25 μl SR primer for Illumina (NEB-kit) ...
-
bioRxiv - Molecular Biology 2020Quote: ... ampicillin resistance gene (Amp) was derived from pUC19 (New England Biolabs) whereas gene expression cassette were amplified from and pET30a (Novagen ...
-
bioRxiv - Biochemistry 2023Quote: ... GST-tag HP1⍺ΔC construct was generated by site-direct mutagenesis kit (NEB) by deleting the amino acids (number 169 –181 ...
-
bioRxiv - Molecular Biology 2021Quote: ... were cloned into pTwist-Amp (Twist Bioscience) using Golden Gate Assembly (NEB). pMK232 was a gift from Masato Kanemaki (Addgene plasmid # 72834 ...
-
bioRxiv - Biochemistry 2022Quote: ... the empty pE-SUMOpro Amp vector was cut using BsaI enzyme (NEB). ORFs were amplified with primers that added 5’-CGCGAACAGATTGGAGGT-3’ upstream of the start of the ORF ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Dephosphorylation of cyclic phosphate groups were carried out with T4 PNK (10 U/uL, M0201, NEB) in a low pH buffer (5X PNK pH 6.5 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Dephosphorylation of cyclic phosphate groups was carried out with T4 PNK (10 U/µL, M0201, NEB) in a low pH buffer (25 mM MES (2-(N-morpholino)ethanesulfonic acid) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reactions were undertaken in 25 ul consisting of 1 x Long amp Taq buffer (NEB), 300 μM dNTP mix ...
-
bioRxiv - Biochemistry 2024Quote: ... All individual PLpro mutations were introduced into pDONR221-PLpro using NEB Q5 Site-Direct Mutagenesis Kit (NEB) following manufacturer’s instructions and shuttled into FU-tetO-Gateway-rtTA-2A-Puro using LR clonase.
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding various dSARM1ARM mutants were generated using the Q5® Site-Direct Mutagenesis Kit (New England BioLabs). Plasmids were transformed into BL21 (DE3 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Pathology 2021Quote: ... These clones were further analyzed by genomic PCR using Long Amp Taq DNA polymerase (New England Biolabs) to check the downstream inserted sequence ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene-specific LA-qPCR assays for measuring DNA strand-breaks (SBs) were performed as described earlier (7,17,18,22) using Long Amp Taq DNA Polymerase (New England BioLabs). 10 ng of genomic DNA was used as a template to amplify transcribed genes (10.4 kb region of the hypoxanthine-guanine phosphoribosyltransferase [HPRT] ...
-
bioRxiv - Biochemistry 2023Quote: ... in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described earlier18,19,41,42 using Long Amp Taq DNA Polymerase (New England BioLabs). Three transcribed (HPRT ...
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Biophysics 2022Quote: ... This construction was used as a template to introduce the mutation W330A using the Q5-Site Direct Mutagenesis Kit (NEB) with the oligonucleotides W330A-fw 5′-GAGCGGTACCGCCCTGACCTATACCG- and W330A-rv 5′-GGGGTAACTTCCATGCCA- ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... and UBA domain (L309D, M332K/Y334F, and ΔYFLLL) mutants were generated using Q5 Hot Start Site Direct Mutagenesis kit (New England BioLabs, E0552S). BRSK2 domain deletion mutations ΔN (Δ kinase) ...
-
bioRxiv - Microbiology 2021Quote: E248R deletion mutant proteins of distinct domains (Δ constructs) were generated from E248R WT plasmid by site direct mutagenesis using the Q5 mutagenesis kit (New England Biolabs) as follows ...
-
bioRxiv - Genetics 2019Quote: ... RNA was isolated from cells using the Direct-zol™ RNA Miniprep Kit and used to generate cDNA (Protoscript II, NEB). Protein was isolated from cells as described above.
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutations were introduced into the ATP11A ORF using a The Q5® Sit-direct mutagenesis kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2022Quote: ... These linearized templates were used to direct in vitro transcription (IVT) of mRNAs using the HiScribe™T7 mRNA Kit with CleanCap® Reagent AG (NEB). Cy3-UTP and Cy5-UTP were used replacing 25% of standard UTP in some experiments to fluorescently label the mRNA transcripts ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products digested by SphI and HindIII were cloned into pQF50-chl and/or pQF50-Amp plasmids using T4 DNA ligase (NEB) to generate the different pMP plasmids (38 ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
bioRxiv - Synthetic Biology 2022Quote: A double-stranded DNA scaffold template was obtained from pUCIDT-AMP-T7p_DB982 plasmid (10 ng in 50 μL reaction mixture) by PCR amplification using Phusion® DNA polymerase (NEB), T7-DB982 forward and T7-DB982 reverse primers (0.5 μM each) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit) followed by a 1 h incubation at 25°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... in YPD supplemented with 100 µg/ml ampicillin and 1% glucose (YPD-Amp-Glu) were infected with M13KO7 helper phage (New England Biolabs, USA) at 7×109 plaque forming unit (PFU ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNA was synthesized from each of these PCR products in the presence of a 50-fold molar excess of AMP over ATP (74) with T7 RNA polymerase (NEB M0251). Each 50 μL reaction contained 1X reaction buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting products were pre-amplified in a 100 μL reaction using 10 cycles with 4 μL pre-amp primers (10x Genomics PN 20002714) and 50 μL of NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S). Reactions were cleaned with 1.6X SPRI and eluted in 40 μL EB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...